Indian Tenders Tender information of India
Global Tenders International Tender information
Projects Project information of India
Tender Awarded Tender awarded information
Sub-Contractor Vendor information of India
Pay Online
Register now
Login
Contact Info All India : 9276083333 / 9274315555 South India : 9274315555

Filters

List of animal-and-animal-feeds Tenders

List of latest animal-and-animal-feeds Tenders in Indian Tenders. Click on any animal-and-animal-feeds Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for animal-and-animal-feeds Tenders.

All-Tenders (26)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government And Public Sector

TRN :35648589 | 06 Nov, 2025

Tender Value : 0

Raipur - Chhattisgarh

Tender for supply of high horse power traction motor 207 kw for 25 kv ac..

Central Government/Public Sector

TRN :35632980 | 05 Nov, 2025

Tender Value : 39.03 Lacs

Bhubneshwar - Orissa

Tender for gem bids for wheat, miaze, soya doc, deoiled rice bran, fish mealwhole fish, osyter shell grit, broken rice

Central Government/Public Sector

TRN :35618194 | 04 Nov, 2025

Tender Value : 0

Bangalore - Karnataka

Tender for gem bids for atta, rice fine quality, rice floor, maida, corn floor, sugar, jaggery, avalakki, puliyogare powder, sooji, toordal, moong dal, black channa, channa dal, moong whole, fried gram, urad dal, kabuli channa, green peas, horsegram, alasande kalu, white rajma, red chilly byadigi, chilly power kashmiri, dhaniya coriander seeds, dhaniyacoriander powder, turmeric powder, methi, mustard, cumin seed jeera, jeera powder, black pepper, blackpepper powder, coconut powder desicates, cloves, cinnamon stick, cardamom, ananas flower, marathimoggu, kasturi methi, biryani leaves, asafoetida, somp, soya bean sauce, japathre, table salt, salt, tamarindseedless, mixed fruit jam, broken wheatyellow, oats, mussali, chocos, cornflakes muesli, vermicelliall verities, custard powder, jamoon mix, dry grapes, cashew nutbroken, cashew nut whole, tea powder, tea bags, coffee, channa masala, chat masala, garam masala, chicken masala, mutton masala, biryani masala, kababmasala, sambar powder, rasam powder, teriyaki sauce, tomato sauce-, vinegar, chilly sauce, lemon salt, noodles, groundnut seeds, bengal gram flour, ragi floor, sunflower oil, ghee, pickle mixed, papad, biscuits sweetsalt khara, food color, sabbakki

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

State Government

TRN :35577030 | 10 Nov, 2025

Tender Value : 0

New Delhi - Delhi

Tender for engagement of internal auditor for fy 2024-25 to fy 2026-27 under world bank assisted fisheries sector prosperity project p174798 engagement of internal auditor

Central Government/Public Sector

TRN :35526794 | 10 Nov, 2025

Tender Value : 0

Ahmedabad - Gujarat

Tender for supply of high horse power traction motor..

1
2
3

Search Other Industries

Get Animal And Animal Feeds Tender Alert...

Search Other Industries

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us

Copyright ©2018 - Thetenders.com.