Filters

List of tetracycline-cap Tenders

List of latest tetracycline-cap Tenders in Indian Tenders. Click on any tetracycline-cap Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for tetracycline-cap Tenders.

All-Tenders (71)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government/Public Sector

TRN :35606421 | 06 Nov, 2025

Tender Value : 15.00 Lacs

Aizwal - Mizoram

Tender for gem bids for chemicals, bid number gem2025b6781711 dated 13-10-2025 bid document1 75 1 1 dichlorophenol indophenols, 3 2 dinitrosalicyclic acid, anthrone, ascorbic acid, infusion agar, cetrimid aga, cetrimide ar, chlorine grnules, depc treated water, diphenylamine, disodium edta, dna, edta disodium, enriched thioglycollate, hydrochloric acid, l arginine, laspartic acid, leucine, lithium chloride, l-proline, orcinolmonohydrate, oxalate, oxalic acid, phenol crystals, piperacillin, rennin, rna, rotheras, sodium carbonate, sodium hydroxide pellets, sodium laureth sulfate, stannous chloride, trisbase, 2 mercaptoethanol, sodiumcitrate, absolute alcohol, albert metachromatic stain kit, alpha feto protein, biuret reagent, carcino embryonicantigen, cholesterol kit, ctab extraction solution, denguecombo, dnase 1 solution, erba triglycerides, esbl, ethylene glycol, fluoride solution, follicle stimulatinghormone fsh, indian ink, leutinisinghormone lh, bilirubin direct, bilirubin total, cholesterol, creatininereagent, glucose mono reagent, hdl direct reagent, ldldirect reagent, potassium reagent, sgot reagent, sgptreagent, triglycerides reagent, urea reagent, uric acidreagent, masson trichrome stain kit, muccarmine stainsolutionotto chem, n hexane, perchloric acid, phenolchloroform, povidone- iodine solution, prolactin, prostratespecific antigen, rapid h e stain kit, rapid oil red ostaining kit, pearl stain kit, ribonuclease, stainingsolution, siver nitratelabogen, sodium hypobromitesolution, sodium hypochlorite, sulfuric acid ar, sulphuricacid ar, te buffer, testosterone, thyroid stimulatinghormone, trizol reagent, universal ph indicator solution, van gieson staining kit, zn stain kit, amoxyclav, asotest kit, bacitracin disc, capsule staining kit, cefadroxil, cefepime disc, cefixime clavulanic aicd, cefotaxime disc, clavulanic acid, cefoxitin disc, cefpodoxime disc, ceftazidime, ceftriaxone disc, cephalexin, ciprofloxacin, cotrimoxazole, crp test kit, distilled water, gas pack, hav igg igm rapid test, hbsag rapid test kit, hcv abrapid test, hcv tridot test kit, hepatitis a rapid test kit, hepatitis e rapid test kit, hev igm rapid test, hiv tridotkest kit, imipenem, nitrofurantoin, norfloxacin, novobiocin disc, ofloxacin, optochin, piperacillintazobactem, pregnancy test kit, ra test kit, rf test kit, scrub typhus test kit, tetracycline, vdrl test kit, widaltest kit

Central Government/Public Sector

TRN :35607511 | 31 Oct, 2025

Tender Value : 0

Dimapur - Nagaland

Tender for gem bids for sadhbhavna, bid number gem2025b6660052 dated 10-10-2025 bid document1 48 0 0 tab paracetamol 650 mg, tab ranitidine 150 mg, tabazithromycin 500 mg, tab cefixime 200 mg, capamoxycillin 500 mg, tab amoxycillin 500 mg and potclavulanate 125 mg, tab cetrizine 10 mg, tab montelucastand levocetrizine, cap omeperazole 20 mg, ciprofloxacin03 percent eye drops 3mg ml bott of 5 ml, eye dropcarboxymethyl cellulose, eye drop olopatadine 5 ml, eardrop para dichlorobenzene benzocaine chlorbutolturpentine oil bott of 10 ml waxole, eye drop moxifloxacin, tab pantoprazole and domperidone, tab multivitamin, tab ibuprofen and paracetamol, tab disprin, tabciprofloxacin 500 mg, tab ibuprofen 400 mg, tab b andcomplex, tab pheniramine maleate 25 mg, tab anticold, eye drop chloramphenicol 1 percent bott of 5 ml, dropnasovion paed, drop nasovion adult, eye dropciprofloxacin and dexamethasone bott of 10 ml, eye dropflurbiprofen bott of 10 ml, ofloxacin lgnocaine hcl andacetic acid ear drop, eye drop hydroxypropylmethylcellulose, eye drop cromolyn sodium, eye dropnephazoline and sodium carboxymethyl cellulose, ear dropbeclomethasone dipropionate neomycin and clotrimazole, ear drop clotrimazole and lignocaine, eye dropchloramphenicol d, eye drop diclofenac, eye dropmoxifloxacin and loteprednol etabonate, eye drophomatropin, eye drop sodium hyaluronate 0 point 18percent, eye drop lotepredinol, eye drop nepafenac, eyedrop opthacare himalaya, eye drop prednisolone, eyedrop propacaine, eye drop calcium potassoim iodide andnacl, eye drop sulphacetamide, eye drop tropicamide, eye oint carboxymethyl cellulose, eye ointchloramphenicol, eye oint ciprofloxacin, eye ointgatifloxacin, eye oint moxifloxacin, eye oint neosporin, eye wear spectacles, d panthenol ophthalmic gel 5percent tube of 5 gm, eye wash solution, nasal dropsaline, carotenoids minerals methylcobalamine and omega3 fatty acids in softgel capsules, eye ear dropbetamethasone sodium phosphate and neomycin sulphate, ear drop gentamycin and d, ear drop neomycin anddexamethasone, ear drop ofloxacin, ear tetracycline andhydrocortisone

Central Government/Public Sector

TRN :35565371 | 22 Oct, 2025

Tender Value : 0

Pondicherry - Puducherry

Tender for gem bids for procurement, 5-fluorouracil injection 50 mgperml amikacininjection 125 mgperml aminophylline injection25mgperml amphotericin b injection 50 mg antihuman thymocyte immunoglobulin rabbitinjection 5mgperml basiliximab injection injection20mg benzyl penicillin injection 600 mg 10 lac iu beractant intratracheal suspension 25mgperml carbetocin injection 100 mcgperml chlorpromazinehydrochloride injection 25 mgperml c-tb injection01 microgramper01 ml dalteparin sodium injection5000 iuper02 ml diltiazem hydrochloride injection5 mgperml doxylamine succinate plus pyridoxinehydrochloride injection fluconazole infusion 2mgperml injection fluorescein sodium injection10percent wperv fluorescein sodium injection20percent wperv glucagon hydrochloride injection1mg glyceryl trinitrate injection 1 mgperml hepatitis b immunoglobulin 100 iuper05 ml hepatitis b vaccine genetically engineered 05 ml human albumin injection 45percent human rabiesimmunoglobulin injection 300 iu insulin aspartinjection 100units per ml insulin detemir injection100unitsperml insulin glargine injection100unitsperml insulin-biphasic isophane insulininjection ip 30percent soluble insulin and 70percentisophane insulin 40 iuperml insulin-biphasicisophane insulin injection ip 50percent solubleinsulin and 50percent isophane insulin 40 iuperml insulin-isophane insulin injection intermediateacting 40 iuperml insulin-soluble insulin injectionrapid or short acting neutral solution 40 iuperml iron dextran injection 50 mgperml isoxsuprinehydrochloride injection 5 mgperml ketamine bid number gem2025b6761416 dated 07-10-2025 bid document1 110 1 1 hydrochloride injection 10 mgperml, ketaminehydrochloride injection 50 mgperml, levofloxacininjection 500 mgper20 ml, lignocaine hydrochloride21.3 mgperml with sodium chloride 6 mgpermlinjection i.v. preservative free, lorazepam injection2 mgperml, methotrexate sodium injection 25mgperml, methyldopa injection 50 mgperml, methylene blue injection 10mgperml, metoprololtartrate injection ip 1 mgperml, mitomycin cinjection 2mg, monoclonal purified antihemophilicfactor viii human injection 1000 iu, monoclonalpurified antihemophilic factor viii human injection250 iu, monoclonal purified antihemophilic factorviii human injection 500 iu, nicorandil injection 48mg, phenobarbitone sodium injection 200 mgperml, phenocaine intracameral preservative freeinjection, pilocarpine nitrate intracameralpreservative free injection, placenta extractinjection, pneumococcal polysaccharide vaccine 23valent 0.5 ml, polidocanol 3percent injection, prochlorperazine mesylate injection 12.5mg per ml, rabies human monoclonal antibody injection 50iuper1.25 ml, recombinant granulocyte monocyte-colony stimulating factor gm-csf 500ug, recombinant human growth hormone injection 0.45mgperml, remdesivir injection 100 mg, sodium 2-mercaptoethanesulphonate injection 100 mgperml, sodium tetradecyl suphate 3percent injection, streptomycin injection 0.75 g, terbutaline injection0.25 mg, tuberculin, purified protein derivativediluted 1 tuper0.1 ml, urokinase injection 5 lac iu, verapamil hydrochloride injection 2.5 mgperml, vitamin a injection 100, 000 iu, zoledranic acidinjection 5mgper100ml, atropine sulphate0.5mgperml ivf, haemo dialysis fluid acetatesolution, haemo dialysis fluid acid concentrate -without dextrose, inj. 3.5percent colloidal infusionsolution of polygeline with electrolytes for ivadministration, fentanyl citrate injection 50mcgperml, fentanyl transdermal patch - 5 mg, morphine sulphate 10mg tablet, morphine sulphateinjection 10 mgperml, pentazocine lactate injectionip 30 mgperml, pethidine hydrochloride injection 50mgperml, autolytic debridement gel, azithromycineye ointment 15percent wperw, benzyl peroxide gel2.5percent, chlorhexidine gluconate obstetriccream 1percentwperw, ciprofloxacin eye ointment0.3percent wperw, conjugated oestrogen 0.625 mgcream, dichloro metaxylenol obstetric cream 1.2percent wperv, estradiol 0.01percent vaginal cream, hydroquinone cream 2percent, salicyclic acid6percent ointment, sodium chloride opthalmicointment 6percentwperw, lactic acid bacilluspowder, l-arginine granules 5gms, nacetylcysteine 10percent solution for inhalationuse, salbutamol sulphate ip respiratory solution5mgperml, benzathine penicillin 2.4mu 1 vial plusazithromycin 1gm 1 tablet plus disposable syringe10ml 1 syringe plus sterile water 10ml 1 phial, activated charcoal 500mg tablet, amoxycillin125mg plus cloxacillin 125mg capsule, amoxycillin250mg plus cloxacillin 250mg capsule, ampicillin250mg capsule, artesenuate 100mg 3 tab plussulphadoxine pyremethemine 750mg plus 37.5mg 1 tab //bid details2 / 110 combi blister pack5-8 years, artesenuate 150mg 3tab plus sulphadoxine pyremethemine 500mg plus25mg 2 tab combi blister pack9-14 years, artesenuate 200mg 3 tab plus sulphadoxinepyremethemine 750mg plus 37.5mg 2 tab combi blisterpack adult, artesenuate 25mg 3 tab plussulphadoxine pyremethemine 250mg plus12.5mg 1 tabcombi blister pack0-1 years, baricitinib 4mg tablet, brincidofovir 100mg tablet, cephalexin 250mgcapsule, cetirizine 5mg tablet, chloramphenicol ip250mg capsule, chlorpheniramine maleate ip 4mgtablet, chlorpromazine hcl 50mg tablet, clindamycin 600mg tablet, clofazimine 100 mgtablet, cloxacillin 500mg capsule, co -trimoxazole pead tablet sulphamethoxazole 100 mgplus trimethoprim 20 mg, co-enzyme q10, l-carnitine, l-tartarate, l-arginine, dha and lycopene tablet, cyclosporine 75 mg capsule, dapsone 100 mg tablet, diethyl carbamazine citrate ip 100mg tablet, essential amino acids, vitamins, methylcobalamin andminerals capsules, etophylline 115mg plustheophylline 35mg tablet sr, griseofulvin 125mgtablet, griseofulvin 250mg tablet, indomethacin25mg capsule, irbesartan 150 mg tablet, isosorbide - 5 - mononitrate 30 mg tablet indurables, lecithin, silymarin, glutatione, zinc, amino acids and vitamin tablet, levocarnitine330mg tablet, levonorgestrel 1.5mg tablet, mebendazole 100mg tablet, mefenamic acid 250 mgtablet, methyl ergometrine maleate 0.125 mgtablet, misoprostol 25mcg tablet, misoprostol50mcg tablet, neostigmine 15mg tablet, niacinamide 500 mg tablet, nifedipine 5mg capsule, norfloxacin 100mg tablet, orciprenaline 10mgtablet, orciprenaline 20mg tablet, oseltamivir 30mg tabletpercapsule, pencillin g potassium 400400, 000 units tablet, phenobarbitone 30mg tablet, riboflavine 10mg, rifampicin 150mg tablet, rifampicin 300mg tablet, rifampicin 600mg tablet, ring pessary, rivaroxaban 10mg tablet, silymarin140 mg tablet, simethicone and activated charcoaltablet, sodium fluoride 20 mg tablet, taurine500mg with n- acetyl cysteine 50mg tablet, tecovirimat 200mg capsule, tetracycline hysrochlorude 500 mg capsule, voriconazole 400mgtablet, amisulpride 200mg tablet, amlodipine 5mgtablet, amoxycillin 250mg capsule, atorvastatin10mg tablet, escitalopram 10mg tablet, famotidine40mg tablet, glimipride 1mg tablet, isosorbidedinitrate ip 10mg tablet, norfloxacin 400mg plustinidazole 600mg tablet, prednisolone ip 5mgtablet, propranolol ip 5mg tablet, thyroxinsodium 25mcg tablet, 2 fdc paediatric-cp isoniazid50plusrifampicin 75 tablet, 3 fdc paediatric-ipisoniazid 50plusrifampicin 75pluspyrazinamide150tablet, clofazimine 100 mg capsule, cycloserine250 mg capsule, delamanid 50 mg tablet, ethambutol 100 mg tablet, ethambutol 200 mgtablet, ethambutol 400 mg tablet, ethambutol 800mg tablet, ethionamide 125 mg tablet, ethionamide25o mg tablet, isoniazid 100 mg tablet, isoniazid300 mg tablet, isoniazid 300mg plus rifapentine300mg 3hp fdc, rifampicin 150 mg capsule, rifampicin 300 mg capsule, rifampicin 450 mg //bid details3 / 110 capsule, rifampicin 600 mg capsule, bismuthsubnitrate and iodoform paste per pack bismuthsubnitrate 20percent, iodoform 40percent and liquidparaffin 40percent, fibrin sealant human kit, halothane solution, mercurochrome powder, podophyllin paint 20percent, sodalime indicator -pink, sodium lauryl sulphate, sodium benzoate andpropyleneglycol hand and body wash lotion, sodium phosphate enema sodium acid phosphate16percentwperv plus sodium phosphate 6percentwperv

Central Government/Public Sector

TRN :35552151 | 27 Oct, 2025

Tender Value : 5.53 Lacs

Datia - Madhya Pradesh

Tender for gem bids for laboratory, 1 5 diphenylcarbazone 10x tbs tris buffer saline 1octanol 2 4dinitrophenylhydrazine 2 4dinitrophenylhydrozine ar 2 butanol 2 thiobarbituric acid abts substrate chromophore diammonium salt aceticacid glacial hi ar acetonitrile gr agar powderbacteriological grade alkalinity testing kit aluminiumchloride anhydrous ammonia solution 25 gr ammoniatesting kit ammonium ferric citrate brown ammoniumhydrogen carbonate extrapure ammonium nitrate ammonium persulfate amphotericin b amt anhydrousglucose aniline ar 2 ascorbic acid bacterial genomicdna purification kitsilica column based bapna benzaldehyde bhi broth brain heart infusion broth bismuth iiisulphate blood agar base infusion agar borax boron trifluoride methanol complex bradford reagent bromophenol blue indicator butylated hydroxytoluene bht calcium carbonate calcium chloride dihydrate calciumhydroxide carboxymethylcellulose sodium salt mediumviscosity 400 800 cps cdna synthesis kit chitosan fromshrimp shells chloramphenicol citric acid extra pureanhydrous cod liver oil copper ii chloride dihydratecrystal pure cucl2h2o copper oxide powder coppersulphate cupric sulphate anhydrous cuso4 cyclonexane di sodium hydrogen orthophosphate anhydrous na2hpo4sod phosp diabasic anhydrous dimethylformamide diphenylamine indicator disodiumethylenediaminetetraacetate dihydrate edta disodiumphosphate dl aspartic acid dl tryptophan dntp mix 10mm ec broth ellman s reagent epinephrine erythromycin antibiotics disc ethanol diluent for dnaextraction feno33 ferric chloride ferrocene c10 h10 fe ferrous ammonium sulphate ferrous sulfate ferrozinec20h13n4nao6s2 folin denis reagent formalin bid number gem2025b6705724 dated 06-10-2025 bid document1 99 1 1 formaldehyde sol 37 41 ar grade, gelatin from porcineskin type a, glutaraldehyde solution 25, glycerolanhydrous, glycine amino acetic acid, guanidinehydrochloride, guar gum, histamine dihydrochloride, hydrochloric acid 2, hydrogen peroxide 30, imidazole ar, indole, irgasan triclosan, iron iii chloride anhydrous, kanamycin sulphate, l ascorbic acid vit c extra pure, labolene, lauryl sulphate broth lauryl tryptose broth, lecithin soya 30, l hydroxyproline, liquor ammoniaammonia soln, lugol s iodine, macconkey agar, magnesium chloride hexahydrate, magnesium oxide ar, magnesium sulfate heptahydrate, maltodextrin plantculture tested, manganous sulphate, mercuric nitratemonohydrate extrapure ar, methanol, methyl orange, methylene blue, mimosine, n octanol, n n n ntetramethyl ethylene diamine temed, na2s2o3 0 1 nampules, naoh 1 n ampules, neomycin antibiotics disc, nhexonic acid caproic acid, nitric acid, nitrobenzene, novobiocinno 5 selective supplement, o chlorophenol 2chloro phenol, oxalacetic acid, oxalic acid dihydrate, papain purified from papaya latex 500 g, pcr master mix, peptone gelatin agar, petroleum ether, petroleum jelly, phenol, phosphate buffered saline pbs ph 7 4, phydroxydiphenyl, picric acid ar, p nmethylaminophenolsulphate, poly ethylene glycol mw 8000, potassiumacetate gr, potassium chloride, potassium dichromate, potassium dihydrogen phosphate, potassium hydrogeniodate, potassium iodide, potassium persulfate, potassiumsodium tartrate, potassium sorbate granular, potassiumthiocyanate, propan 2 ol 2 propanol isopropyl alcohol, propyl gallate, pvc poly vinyl chloride, radialimmunodiffusion teaching kit, salicylic acid, seleniumdioxide, silver sulfate, sodium acetate trihydrate, sodiumazide, sodium bicarbonate, sodium chloride, sodiumcitrate, sodium dithionite, sodium floride, sodiumhydroxide pellets, sodium hypochlorite, sodiummetabisulphite, sodium molybdate dihydrate, sodiumnitropruside, sodium phytate phytic acid sodium salthydrate, sodium propionate, sodium silico fluoride, sodium sulphate anhydrous, sodium thiosulphate, sodiumtri poly phosphate stpp, soyabean casein digest mediumtryptone soya broth, standard solution of seawater, starchagar, starch soluble, sulfanilamide, sulfosalicyclic acid, syringe filter 0 45 micrometer, tannic acid, tca trichloroacetic acid, tetracycline, thiamine hydrochloride, totalhardness kit, trichloro acetic acid, tricine, triethylamine, tris glycine sds gel running buffer 10x, tris saturatedphenol, tris free base, trizol, ttb, tween 80, vanillinreagent, yeast extract powder, zinc chloride dry, zincsulfate monohydrate

Central Government/Public Sector

TRN :35608251 | 25 Oct, 2025

Tender Value : 28.94 Lacs

Agra - Uttar Pradesh

Tender for gem bids for mh, ibuprofen 200 mg tab, povidone iodine 10percent solutionbott of 100 ml, tinidazole 500 mg tab, paracetamol 325mg plus diclofenac sodium 50 mg tab, roxithromycin 150mg tab, albendazole 400 mg tab, ofloxacin 400 mg tab, losartan 25 mg tab, losartan 50 mg tab, diclofenac 25mgperml ip 3 ml inj, ibuprofen 400 mg tab, aceclofenac100 mg tab, levofloxacin ip 250 mg tab, ciprofloxacin500 mg plus tinidazole 600 mg tab, fluconazole 150 mgcappertab, inj cefoperazone 500 mgplus sulbactum 500mg vial, inj benzathine penicillin 12 00 000 i.u. vial, povidone iodine 5percent ointment 250 gm jar, ranitidine150 mg tab, vitamin b complex with a minimumconcentration of vit b1-5mg vit b6-3mg and vit b12-5mcgtherapeutic tabpercap, diclofenac gel 1percent tube of 30gm, amikacin sulphate 250 mgper2 ml inj, cefotaximesodium 1gm inj, ceftazidime 1 gm inj, ceftriaxone 1 gm inj, cefuroxime 250 mg tab, cefixime 100 mg tab, doxycycline cap 100mg, gentamycin sulphate inj imperiv40mgperml 2 ml inj, azithromycin 500 mg tab, meropenem 500 mg inj, inj amikacin sulphate 250mgperml, adhesive plaster zinc oxide 2.5cm x 1mtr, bandage triangular, compression elastic bandage for dvtsmall, compression elastic bandage for dvt medium, compression elastic bandage for dvt large, lint absorbentcotton, adjustable arm pouch sling large medium andsmall, foleys balloon catheter 2 way silicon 16g, foley surinary catheter siliconeperantibacterial coated 3 way size-14, foley s urinary catheter siliconeperantibacterialcoated 3 way size -16, foley s urinary cathetersiliconeperantibacterial coated 3 way size -18, glucostripsone touch select bott 50 tripsferopenem 200mg tab, flupentiol 0.5mg + melitrxcen 10mgtab, flupirtine 100 mg er tab, fungal diastase 50 mg tab, /bid number: gem/2025/b/6741185* /dated: 11-10-2025 & & / bid document1 / 59 ginko biloba 120mg tab, gliclazide 80 mg tab, glimepride2mg + metformine 500 mg tab, glimepride 1mg +metformine 500 mg tab, glimepride 2mg + metformine sr1gm tab, glucosamine 500mg + diacerin 50mg tab, glycopyrolate 2 mg tab, iguratimod 25 mg tab, imipramine25 mg tab, lacosamide 100 mg tab, lacosamide 200 mgtab, lacosamide 50 mg tab, levetiracetam 250 mg tab, linagliptin 2.5 mg +metformin 1000 mg tab, linagliptin 2.5mg +metformin 500 mg tab, loratidine 10 mg tab, mebeverine 200 mg tab, megesterol acetate 80 mg tab, melalatonin 3 mg tab, mesalamine 1.2 gm tab, methylcobalamin 500 mcg tab, methylprednisolone 8 mgtab, mifenamic acid 250mg + tranexamic acid 500mg tab, moxonidine 0.2 mg tab, moxonidine 0.3 mg tab, nifedipine10 mg sr tab, nifedipine r 20 mg tab, nitroglycerine 6.4 mgtab, olmisartan 40mg + hydrochlorthiazide 12.5 mg tab, posaconazole 100 mg tab, rifaximine 400 mg tab, rosuvastatin 10 mg tab, rosuvastatin 40 mg tab, safinamide 50mg tab, selegilne 05 mg tab, serratiopeptidase 10 mg tab, simvastatin 10 mg tab, sitagliptin phosphate 50 mg tab, sofosbuvir 400 mg +velpatasavir 100 mg tab, tenilgliptin 20 mg tab, tenilgliptin20 mg+metformin 500 mg tab, tenofovir 300 mg +ajenamide 25 mg tab, thiocolchicoside 4 mg tab, tizanidine2 mg tab, tolperisone hcl 150 mg tab, topentadol 50 mgtab, torsemide 10 mg+spironolactone 25 mg tab, torsemide 20 mg tab, trifluoperazine 05 mg tab, trifluoperazine 05 mg +trihexiphenidyl 02 mg tab, ubiquinol 100 mg tab, vilazodone 20mg tab, tacrolimus0.1% w/w tacvido forte oint 20gm, trypsin 96mg+bromelain 180mg + rutoside trihydrate 200mg tab, ungacyclovir skin 5 % w/w tube of 5 gm, collagen peptide 40mg + sodium hyaluronate 30 mg tab, glucostrips foraccucheck active bott of 50 strips, hydrochlorothiazide 12.5mg tab, eye gel hydroxypropyle methyl cellulose 0.3% w/wbott of 10ml, megestrol acetate 160 mg tab, vit b121500mcg + alpha 100mg + myo 100mg + fa 1.5mg +selen 55mcg cap, naproxen 500 mg tab, nebivolol 2.5 mgtab, neomercazole carbimazole 10mg tab, neomycin+beclometahsone +clotrimazole e/d 5 ml, nepafenac0.3%w/v 5 ml ed, nitroglycerin 2.6mg tab, ointbeclomethasone + salicylic acid 20 gm tube, olanzapine 2.5mg tab, pancreatin 10000 iu tab, piracetam 400 mg tab, pregabalin 75 mg + nortriptyline 25 mg tab, rosuvastin 10mg + aspirin 75 mg +clopidogril 75 mg tab, rotacapfluticasone 100mcg + salmetrol 50mcg / dose, saxagliptin2.5 mg tab, serrratiopeptidase 5 mg tab, sertraline 25 mgtab, silodosin 4 mg + dutasteroide 0.5 mg tab, silodosin 8mg + dutasteroide 0.5 mg tab, silymarin 70 mg tab, sodium valproate 300 mg cr tab, sodium valproate500mg tab, spironocatone 25 mg +frusemide 20 mg tab, spironolactone 50 mg tab, syrup iron + folic acid bott of200 ml, sgpt kit of 5 x 20 ml, sgot kit of 5 x 20 ml, glucose test kit 2 x 200 ml, blood urea reagent 1 2x60ml& reagent 2 60ml, bilirubin total + direct reagent 1 2x60micro ltr and reagent 2 2x60 micro ltr, uric acid kit of 5x20micro ltr, serum creatinine, reagent 1 2x60ml reagent 22x60ml, triglycerids kit of 5x20 micro ltr, cholesterol kitof 5 x 20 ml, urine sugar strips, each bottle of 100 strips, typhidot box of 50 test, total protein kit of 5x50ml, alkalinephosphate kit of 10x2.2 micro ltr, calcium kit of 5 x 20micro ltr, albumin kit of 5 x 50 ml, widal kit of 5ml x 4, rafactor kit of 50 test, adhesive plaster, zinc oxide, 2.5cm x1mtr, trioxsalen 25 mg tab, valacyclovir hydrochloride 500 //bid details2 / 59

Central Government/Public Sector

TRN :35608380 | 25 Oct, 2025

Tender Value : 0

Srinagar - Jammu And Kashmir

Tender for gem bids for enalapril 5 mg tab entacavir 0point5 mg tab enteral feedpowdercomma protein 85percentcomma eplerenone 25mg tab tab escitalopram 10 mg estriol 1 mg vaginalcream evalon etoricoxib 120 mgcomma tab edtobramycin 0point3percent bott of 5 ml ed gentamicinsulphate 0point3percent wv gentamicin ciprofloxacin hcl0point3percent tube of 5 gmpoint fenofibrate 200 mg tab fentanyl 25 mcg transdermal fexofenadinehydrochloride 120 mg tab tab fexofenadine 180 mg tabfinasteride 5mgpoint tab flavoxate 200 mg fluconazolecaptab 150mg tab flunarizine 10 mg cap fluoxetine 20mg fluvoxamine 50 mg cap formoterol 6 mcg plusglycopyrronium 25 mcg dry rotacap tiotropium bromide18 mcg plus formeterol framycetin sulphate cream bp1percent 100 gms tab frusemide 20mg plusspironolactone 50 mg frusemide 40 mg tab gammabenzene hexachloride 1percent wv cntrimide edgatifloxacin 0point3percent eye drop bott of 5 ml gauzesurgicalcomma open wovecomma unmedicated tabglipizide 5 mg glucosamine 250 mg plus chondrotinsulphate 200 mg cap glucosamine 500 mg tab tabnitroglycerine 2point6 mg gum paint bott of 15 ml 0point05 per halobetasol propionate plus 3 percent salic haloperidol 5 mg tab haloperidol syp 2mgml bott of 30 ml tab hydrocortisone 5 mg hydrogen peroxide solutionwith stabilizer ip 20 vol hydroxyurea 500 mg cap tabibandronate 150 mg ibuprofen syrup 100mg5ml bott of 50ml ibuprofen 200 mg tab imipramine 25 mg tab indomethacin 25mg tabcap inh budesonide 200mcg formoterol 6 mcg plus tiotropium 9mcg mdi inahler salmeterol 25 mcg plus fluticasone 125 mg mdi co pheniramine maleate inj 22point75 mg per ml amp of 2ml adrenaline tartrate 11000comma 1 ml inj inj denosumab bid number gem2025b6752532 dated 11-10-2025 bid document1 108 0 0 60mgml, dexamethasone sodium phosphate 4point4 mg e, inj drotaverin hcl 1percent 20mgml amp of 2ml, frusemide 20 mg comma2 ml inj, injpointhydrocortisonesodium succinate 100mg, hydroxyprogesterone caproate500 mg2 ml amp of 2 ml inj, levofloxacin 500 mg inj, lignocaine hcl 2percent with adrenaline 180000, injmethoxy polyethylene glycolepoetin beta 50, injmultivitamin iv 210 ml with minimum constituents, injmethoxy polyethylene glycolepoetin beta 100 mc, nandrolone decanoate 25mgml inj, paracetamol150mgmlcomma 2 ml inj, paracetamol 10 mgml infusion in100 ml bott, pneumococcal conjugated polysaccharidevaccine 0poin, tramadol hcl 50mgml injpoint, injtranexamic acid 500 mg5ml, tetanus toxoidcommapurified absorbed rubber capped, inj zolendronic acid 5 mg, inj insulin highly purified isophanehuman nph40iumlcomm, insulin premixed biphasic 40 iu per ml30percent human ne, disposable insulin syringe 1ml, ipratropium bromide respirator soln 500 mcg2ml resp of 2ml, isapgol ispaghula husk 3point5 gm, isosorbidemononitrate 20 mg tab, tab isosorbide dinitrate 10 mg, ivermectin tab 6 mg perpntab, ketorolac 10 mg tab, tablcarnitine 500 mg, leflunomide 20 mg tab, tab letrozole2point5 mg, tab levetiracetam 1000mg, leveteracetam500mg tab, levofloxacin 250 mg tab, tab levosulpride 25mg, lithium carbonate 300 mg captab, lorazepam 1 mgtab, lorazepam 2mgmlcomma 2 ml injpoint, losartan 50mg tab, lotepredenol etabonate 0point5percent bott of 5ml, mebeverine hcl 135mg tab, tab metformin 500 mgplus vildagliptin 50 mg, methotrexate 5 mg tab, methylprednisolone 16 mgcomma tab, tabmethylprednisolone 4 mg, tab metoclopramide 10 mg, metronidazole 1 percent tube of 30gm, minoxidil 5 percentlotion bott of 60 ml, tab naproxen 250 mg, nebivolol 5mgtab, tab nicorandril 10mg, nicorandil 5 mg tab, olanzapine 10 mg tabpoint, tab olanzapine 5 mgpoint, tab olapatadine 5 mg, ondansetron 8 mg tab, ondansetron syp 2 mg5ml in bott of 30 mlpoint, pancreaticenzyme supplement with a lipase content o, tabparacetamol 500 mg plus ibuprofen 400 mg, paroxetine 25mg tab, paroxetine xr 12point5 mg tab, tab pazopanib400 mg, perindopril 4mg tab, cream permethrine 5percent tube of 30gmpoint, pheniramine maleate of 25 mgtab, pioglitazone hydrochloride 15 mg tabpoint, tabpiroxicam 20 mg, povidone iodine solution 5percent bott of100 ml, pregabalin 75mg methylcobalamine 1500mcg tab, propranolol tr 40 mg tab, tab quetiapine 100mg, tabquetiapine 50 mg, ranitidine 150 mg tab, erythropoietinrecombinant human 4000 iupoint, tab rifaximin 400mg, cap rifaximin 550 mg, risperidone 1 mgml syp in bott of30 ml, tab risperidone 2 mg tab, tab risperidone 4 mg, tab rivaroxaan 10mg, rizatriptan 5 mg tab, tab sacubitril24 mg plus valsartan 26 mg, tab sacubutril 49mg plusvalsartan 51mg, salmeterol 50 mcg plus fluticasone 500mcgcomma a, tab saroglitazar 4 mg, tab saxagliptin 5mg, tab sertraline 100 mg, sertraline 50mg tabpoint, tabsevelamer 800 mg, sevelamer 400 mg tab, sildenafilcitrate 50 mg tab, silodosin 8 mg tab, tab simvastatin20mg, sitagliptin 50 mgplusmetformin 1000 mg tab, sodium chloride 0point65percent wv nasal drops of 15 ml, sodium valproate 200 mg tab, tab solifenacin 5mg, sterile water for amp of 10 mlpoint, sucralfate suspension1gm5ml bott of 200 ml, sulphamethoxazole 400 mgtrimethoprim 80 mg tabenalapril 5 mg tab, entacavir 0point5 mg tab, enteral feed

State Government

TRN :35610174 | 29 Oct, 2025

Tender Value : 10.00 Crore

Chandigarh Ut - Chandigarh

Tender for gem bids for reagent kit sodium for 05 years, reagent kit potassium for05 years, reagent kit chloride for 05 years, reagent kitglucose for 05 years, reagent kit urea for 05 years, reagent kit creatinine for 05 years, reagent kit uric acidfor 05 years, reagent kit calcium for 05 years, reagent kitphosphorus for 05 years, reagent kit magnesium for 05years, reagent kit total bilirubin for 05 years, reagent kitconjugated bilirubin for 05 years, reagent kit alkalinephosphatase for 05 years, reagent kit sgot for 05 years, reagent kit sgpt for 05 years, reagent kit total protein for05 years, reagent kit albumin for 05 years, reagent kitggt for 05 years, reagent kit amylase for 05 years, reagent kit lipase for 05 years, reagent kit total ck for 05years, reagent kit cpkmb for 05 years, reagent kit crp for05 years, reagent kit hscrp for 05 years, reagent kit rafactor for 05 years, reagent kit cholesterol for 05 years, reagent kit tg for 05 years, reagent kit hdl for 05 years, reagent kit ldl for 05 years, reagent kit apoa for 05 years, reagent kit apob for 05 years, reagent kit ada for 05years, reagent kit ldh for 05 years, reagent kit iron for05 years, reagent kit d dimer for 05 years, reagent kithba1c for 05 years, reagent kit cystatin c for 05 years, reagent kit ammonia for 05 years, reagent kit urinarytotal protein for 05 years, reagent kit csf total protein for05 years, reagent kit urinary albumin for 05 years, reagent kit urinary microalbumin for 05 years, reagent kitinsulin for 05 years, reagent kit ft3 for 05 years, reagentkit ft4 for 05 years, reagent kit tsh for 05 years, reagentkit vitamin d for 05 years, reagent kit vitamin b12 for 05years, reagent kit psa for 05 years, reagent kit afp for 05years, reagent kit ca 125 for 05 years, reagent kit ceafor 05 years, reagent kit cortisol for 05 years, reagent kitferritin for 05 years, reagent kit ipth for 05 years, reagent kit pct for 05 years, reagent kit total hcg for 05years

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Central Government/Public Sector

TRN :35612291 | 04 Nov, 2025

Tender Value : 0

Dharwad - Karnataka

Tender for gem bids for fast protein liquid chromatography, gel or blot imagingsystem i, gel or blot imaging ii, chiller for sonicator, animal blood pressure system

Central Government And Public Sector

TRN :35612821 | 17 Oct, 2025

Tender Value : 0

Jalpaiguri - West Bengal

Tender for supply of recombinant rabies g protein 50mcg/0.5ml 3 dose anti-rabies vaccine in vial.

Related Searched Keywords : tetracycline cap

List of tetracycline-cap Tenders

Tender for gem bids for fast protein liquid chromatography, gel or blot imagingsystem i, gel or blot imaging ii, chiller for sonicator, animal blood pressure system

Tender for supply of recombinant rabies g protein 50mcg/0.5ml 3 dose anti-rabies vaccine in vial.

Get tetracycline cap Tender Alert...

Related Searched Keywords : tetracycline cap

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us