Thetenders.com
  +91 92760 83333 / +91 92743 15555
  • Indian Tenders
  • |
  • Global Tenders
  • |
  • Projects
  • |
  • Tender Awarded
  • |
  • Sub-Contractor
  • Pay Online
  • Register now
  • Login
  • Indian Tenders Tender information of India
  • Global Tenders International Tender information
  • Projects Project information of India
  • Tender Awarded Tender awarded information
  • Sub-Contractor Vendor information of India
  • Pay Online
  • Register now
  • Login
  • Contact Info All India : 9276083333 / 9274315555 South India : 9274315555
TheTenders
»
Indian Tenders
»
SubIndustry Tenders
»
Detector
Filters
  • » By Keywords
  • » By Cities
  • » By States
  • » By Agencies
  • » By Sectors
  • » By Ownerships
  • Tender Value

List of detector Tenders

List of latest detector Tenders in Indian Tenders. Click on any detector Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for detector Tenders.

Advance Search
  • All-Tenders (46)
  • |
  • Today's-Tenders
  • |
  • Active-Tenders
  • |
  • Closed-Tenders
1 Railway Transport
image image
Central Government / Public Sector
TRN :35631539 |  10 Dec, 2025
Tender Value : 3.24 Crore
 Secunderabad - Telangana
Tender for providing architectural and technical consultancy for planning, designing, engineering and preparation of detailed project report including feasibility study for setting up of tier-iii disaster recovery data center along with allied structures including design of green rated building with building services, water tank, site development, stp/etp etc., and non-civil works such as driver face in auto number plate recording system, baggage scanners, door frame metal detectors, boom barrier, emergency light and signages and it includes design of electrical systems such as ups system, intelligent pdu, air-conditioning system, power supply systems including internal electrical installations and electrical sub-station. it covers the design of cctv surveillance system access control system, rodent repellent system, water leakage system, fire suppression system etc. it includes design of network systems such as infrastructure of internet gateway, fois net and utn, data center lan network security, adc, slb and waf, internet bandwidth triplication links and drwan, campus lan and network operations. it includes development of data center infrastructure management software and obtaining uptime tier-iii, tia rated-3 data center design certification. the rate includes complete design with design basis report and dpr.
  • View Tender
  • Document
  • Bid Support
2 Railway Transport
image image
Central Government / Public Sector
TRN :35634771 |  03 Nov, 2025
Tender Value : 79.95 Lacs
 New Delhi - Delhi
Tender for replacement of bms fire detectors installed in 2nd and 3rd floor of ircons corporate office building and 6 year camc for bms system.in all respects.
  • View Tender
  • Document
  • Bid Support
3 Security Services
image image
Central Government/Public Sector
TRN :35635800 |  25 Oct, 2025
Tender Value : 0
 Sriganganagar - Rajasthan
Tender for gem bids for dglp, erba kit for estimation of glucose erba kit for estimationof urea erba kit for estimation of creatinine erba kit forestimation of uric acid erba kit for estimation ofcholesterol erba kit for estimation of protein erba kit forestimation of albumin erba kit for estimation of alkalinephosphatase erba kit for estimation of sgot erba kit forestimation of sgpt prothrombin time reagent to givecontrol of 10 to 14 sec vial of 10 ml pttk reagent withcalcium chloride glycerine hiv i and ii rapid test ketodiastix bott of 50 drabkins solution cyanmetheamoglobinmethod blood sedimentation rate pipette westergren bluestar glass cover microscope 18 mm square 10 gm pkt bluestar glass cover microscope 22 mm square 10 gmspkt occult blood test kit 50 test sodium hypochloritesolution 5 percent bluestar slide microscopic 75 mm x25 mm x 1 point 35 mm methylene blue stain ready to use strip albumin and glucose bott of 100 strips borosilglass tube test 100 mm x 25 mm micropipette variablevolume 5 50 microlit micropipette variable volume 50 to200 microlit micropipette variable volume 100 to 1000microlit erba kit for estimation of triglycerides erba kitfor estimation of bilirubin total plus direct coral kit forestimation of gama glutamyltransferase ggt coral kitfor estimation of ck mb erba kit for estimation of calcium erba kit for estimation of amylase coral kit forestimation of ldh vdrl slash syphillis rapid card test diluent for hematology analyser erba h 360 lyse forhematology analyser erba h 360 h clean for forhematology analyser erba h 360 microtips 5 to 200microlit microtips 100 to 1000 microlit hand gloves size 7 alcohol dehydrated erba kit for estimation of hdlcholesterol preganews pregnancy strips may andgrunwalds stain ready to use 1000 ml bott pm kit for bid number gem2025b6778365 dated 15-10-2025 bid document1 93 0 0 erba chem 5 plus, pm kit for erba chem 7, erba norm, erba path, malaria paracheck antigen detection kit, widal test kit, erba kit for estimation of lipase, erba kitfor estimation of hba1c for semi auto analyser, denguerapid card test ns ag plus igg igm, ra factor kit, distilledwater, esr tube wintrobes method, sterile urinecontainer, wbc diluting fluid, semen diluting fluid, erbawash, antisera anti ahg, siemens 10sg urine multistixbott of 100 strips, finecare kit for estimation of t3, finecare kit for estimation of t4, finecare kit forestimation of tsh, snap pack for electrolyte analyserroche 9180, deprotenizer for electrolyte analyser roche9180, sodium electrode conditioner for electrolyte analyserroche 9180, na electrode for electrolyte analyser roche9180, k electrode for electrolyte analyser roche 9180, caelectrode for electrolyte analyser roche 9180, referenceelectrode for electrolyte analyser roche 9180, referenceelectrode housing for electrolyte analyser roche 9180, isetrol control for electrolyte analyser roche 9180, fpdxh 500 control 6 x 2 point 3 ml beckman coulter, dxh560 lyser beckman coutler, typhidot, microscope lenscleaning solution, milk adulteration test kit, lignocaine hcl2 percent with adrenaline 1 is to 80000 30 ml inj, atropinesulphate 0 point 6 mg 1 ml inj, diclofenac sodiumsuppository 100 mg, paracetamol 1 gm per 100 ml inj bottof 100 ml, adrenaline tartrate 1 is to 1000 1 ml inj, montelukast 10 mg plus levocetirizine 5 mg tab, pheniramine maleate inj 22 point 75 mg per ml amp of 2 ml, noradrenaline bitartrate 2 mg per ml 2 ml inj, pheniramine maleate 25 mg tab, prednisolone 5 mg tab, promethazine hcl 2 point 5 percent 25 mg per ml 2 ml inj, pralidoxime 500 mg per 20 ml inj, lorazepam 2 mg per ml2 ml inj, doxophyllin 400 mg tab, primaquine 7 point 5mgbase tab, silver sulphadiazine 1 percent ointment 20 gmtube, methotrexate 5 mg tab, ropinirole 1 mg tab, trihexyphenidyl hcl 2 mg tab, tab levodopa 125 mg, mannitol 20 percent 100 ml bottle, fenofibrate 160 mg tab, diltiazem 90 mg tab, labetalol hcl 100 mg tab, propranolol tr 40 mg tab, povidine iodine 2 percentgargles 100 ml bottle, antiseptic mouth wash containingsodium fluoride and triclosan bott of 100 to 150 ml, chlorhexidine mouth wash with 0 point 12 percent sugar, alcohol free bottle of 450 to 500 ml in amber colouredbottle, calamine 8 percent with 10 percent light liquidparaffin 50 ml bott, benzoyl peroxide 2 point 5 percenttube of 20 gm, clindamycin phosphate 1 percent topicalgel tube of 10 gm, shampoo ketoconazole 2 percent pluszinc pyrithione 1 percent bott of 100 ml, paradichlorobenzene 2 percent w by v benzocaine 2 point 7percent w by v chlorbutol 5 percent turpentine oil 15percent w by v bott of 10 ml, povidone iodine 5 percentsolution 100 ml bottle, sodium hypochlorite 5 percent, chloroxylenol solution dettol, hydrogen peroxide solutionwith stabilizer ip 20 volume 500 ml bott, bacillus clausii 2billion spores per 5 ml, rifaximin 550 mg cap, tabtenofovir 25 mg, tab levosulpiride 25 mg, hyoscinebromide inj 20 mg per ml per 1 ml inj, mebeverine hcl 135mg tab, enema sodium phosphate 6 percent sodium acidphosphate 16 percent pack of 100 ml, glycerinesuppositories child size 2 g, bisacodyl 5 mg tab, norflox400 mg plus tinidazole 600 mg tab, rifaximine 400 mgtab, hydroxyprogesterone caproate 500 mg per 2 ml ampof 2 ml inj, clotrimazole vaginal pessary 100 mg tab, tabestradiol valerate 2 mg pack of 28, oxytocin 5 units per 1    //bid details2 / 93 point 0 ml amp inj, magnesium sulphate 50 percent w by vinj, evalon cream tube of 15 gm by aspen, glycopyrrolate 0 point 2 mg per ml 1ml inj, pyridostigmine60 mg tab, tab l carnitine 500 mg, travoprost 0 point 004percent bott of 2 point 5 ml eye drops, betahistinedihydrochloride 8 mg tab, prochlorperazine maleate 5mgtab, ondansetron syp 2 mg per 5ml in bott of 30 ml, duloxetine 20 mg tab, aripiprazole 10 mg tab, olanzapine10 mg tab, olanzapine 5 mg tab, paroxetine xr 12 point 5tab, tab quetiapine 100 mg, etophylline bp 84 point 7 mgand theophylline ip 25 point per ml 2 ml inj, ipratropiumbromide respirator soln 500 mcg per 2 ml respule, dextrose 50 percent 25 ml inj, dextrose inj 25 percent 25ml inj, sodium bicarbonate 7 point 5 percent amp of 10 ml, disodium hydrogen syp, alfuzosin 10 mg tab, silodosin 8mg tab, povidone iodine 10 percent solution bott of 100 ml, cap b complex plus vit c plus zinc sulphate zevit orzincovit, calcium 9 mg plus calcium gluconate 50 mg injfor iv use 10 ml injection, multi vit inj iv 2 to 10 ml withminimum constituents having thiamine b1 30mg per mlpyridoxine b6 30 mg per ml and b12 cyanocobalamin 300mcg per ml
  • View Tender
  • Document
  • Bid Support
4 Security Services
image image
Central Government/Public Sector
TRN :35619287 |  24 Oct, 2025
Tender Value : 0
 Udhampur - Jammu And Kashmir
Tender for gem bids for syphilis antibody rapid test 1x50, hiv l and ll rapid test kit1x50, rapid card screening for hbv 1x50, rapid cardscreening for hcv, dengueduo ns 1 ag and igg and igm 10tests rapid, typhoid rapid test kit 1 x 30 test, g6pd kit of12 test, pa confirm test for water testing, suspensionsolution for id and ast compatible with vitek 2 3x 500mlbottle, hiv antibody 1 and 2 detection elisa kit for 96 test
  • View Tender
  • Document
  • Bid Support
5 Railway Transport
image image
Central Government/Public Sector
TRN :35620250 |  30 Oct, 2025
Tender Value : 0
 Howrah - West Bengal
Tender for supply of rapid dengue ns1 ag & ab test. rate to be quoted per test basis kit should be able todetect infection from day 1with dengue virus ns-i ag and differential detection of igm & igg antibodies 2. kit shouldbe able to detect both primary and secondary infection 3. kit should detect all the four dengue serotype den1, den2, den3, den4 4. test result should be given within 15 mints 5. shelf life should be at least 15 mints at 2degree -8 degree c 6. kit should comply with more than 90% sensitivity and more than 95% specificity for ns-i agtest, igm, igg antibody..
  • View Tender
  • Document
  • Bid Support
6 Electrical Products
image image
Central Government/Public Sector
TRN :35623033 |  29 Oct, 2025
Tender Value : 0
 Visakhapatnam - Andhra Pradesh
Tender for gem bids for vz9700001644 gas detectors along withaccessories, vz9700001652 beacon along withaccessories, vz9700001660 hooter along withaccessories, vz9700001679 mandatory spares, 3000004320 supervision of e and c of gas detectors
  • View Tender
  • Document
  • Bid Support
7 Scientific Research/Instruments
image image
Central Government/Public Sector
TRN :35625239 |  30 Oct, 2025
Tender Value : 0
 Indore - Madhya Pradesh
Tender for gem bids for portable arsine ash3 gas detector
  • View Tender
  • Document
  • Bid Support
8 Security Services
image image
Central Government/Public Sector
TRN :35608886 |  23 Oct, 2025
Tender Value : 0
 Ambala - Haryana
Tender for gem bids for basic electrical engg, electricians trouble shooting andtesting, a text book of electrical tech, maintenance ofelectrical eqpt, installation commissioning and testing ofsubstain, basic of uav, cambridge igcse info and comntechnology third edition, methonoil fuel cell sys advancingtowards commercialization, latest technology for efficientbatteries, computer sys, computer hardware repair, computer networking, computer aided design cad, computer artificial and robotics, unstanding fir armsballistics badic to adv ballistics, mil sa of the 20 century, high speed electronics and opto electronics, essential ofopto electronics, fundamentals of infra red detectorsmaterials, principle of electronics, laser and optoelectronics, modern radar sys
  • View Tender
  • Document
  • Bid Support
9 Education And Research Institutes
image image
Central Government/Public Sector
TRN :35610475 |  03 Nov, 2025
Tender Value : 16.98 Lacs
 Nainital - Uttaranchal
Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5
  • View Tender
  • Document
  • Bid Support
10 Security Services
image image
Central Government/Public Sector
TRN :35615140 |  23 Oct, 2025
Tender Value : 16.68 Lacs
 Rampur Up - Uttar Pradesh
Tender for gem bids for dglp, bid number gem2025b6729350 dated 13-10-2025 bid document1 50 1 1 eppendrof tube 0.5 ml plastic pkt of 100, sample cupsystem pack for em 200 pkt of 500, xl - multical systempack for em 200 4 x 3 ml, autowash system pack forem 200 10 x 100 ml, urea system pack for em 200 5 x44 ml oblique 5 x 11 ml, xl autowash ac oblique al kitsystem pack for em 200 5 x 44 ml oblique 5 x 44 ml, control reagents for em 200 normal oblique norm 1 x 5ml, control reagents for em 200 high oblique path 1 x 5ml, creatinine - enzymatic system pack for em 200 5 x30 ml 5 x 10 ml, cholesterol system pack for em 200 10x 44 ml, triglyceride system pack for em 200 5 x 44 mloblique 5 x 11 ml, direct hdl system pack for em 200 4x 30 ml oblique 4 x 10 ml, uric acid system pack for em200 5 x 44 ml oblique 5 x 11 ml, bilirubin total systempack for em 200 6 x 44 ml 6 x 12.3 ml, bilirubin directsystem pack for em 200 6 x 44 ml oblique 6 x 12.3 ml, sgot - el system pack for em 200 6 x 44 ml oblique 6 x12.3 ml, sgpt - e system pack for em 200 6 x 44 mloblique 6 x 12.3 ml, alkaline phosphatase system packfor em 200 2 x 44 ml oblique 2 x 11 ml, amylase systempack for em 200 5 x 22 ml, lipase xl system pack forem 200 1 x 44 ml oblique 1 x 11 ml, ldh - p system packfor em 200 2 x 44 ml oblique 2 x 11 ml, ggt systempack for em 200 2 x 44 ml 2 x 11 ml, ckmb system packfor em 200 2 x 12 ml oblique 2 x 3 ml, cknac systempack for em 200 2 x 12 ml 2 x 3 ml, calcium a systempack for em 200 5 x 6 ml, magnesium system pack forem 200 2 x 44 ml, phosphorous system pack for em 2005 x 6 m, xl crp with calibrator system pack for em 2002 x 22 ml oblique 1 x 11 ml, contro h aso oblique rfoblique crp system pack for em 200 1 x 1 ml, contro laso oblique rf oblique crp system pack for em 200 1 x1 ml, hba1c with calibarator system pack for em 200 2 x15 ml oblique 2 x 5 ml oblique 5 x 0.5 ml, hba1c con hsystem pack for em 200 1 x 0.5 ml, hba1c con lsystem pack for em 200 1 x 0.5 m, ec cartridge s 250tfor ec 90 - next generation electrolyte analyser, ec 90urine diluent 1x100ml for ec 90 - next generationelectrolyte, diluent 20 ltrs for genrui automatedhematology analyser, l h lyse 200 ml for genruiautomated hematology analyser, diff lyse 500 ml forgenrui automated hematology analyser, cell clean, stromatolyser, h pylori detection rapid test kit, chikengunai detection rapid test kit, kit for estimation of cpk cknac 2x8 oblique 2x2 ml, kit for estimation of ck - mb 2x8obliuqe 2x2 ml, paracheck for pv or pf kit of 50 falcivax, rapid card screening for hbsag 50 test oblique kit, stripsalbumin and glucose bottle of 100 strips, d - dimer kit 25assay quantitative for sami auto analyser, c reactiveprotein kit for 50 tests, pap stain kit, disposable pap smearkit pack of 50 kits, typhi dot test kit 30 test oblique kit, dengue test kit 10 test oblique kit, leishmans stainrtu bottle of 500 ml, reticulocyte stain rtu bottle of 500ml, glucose god - pod system pack for em 200 10 x 44ml, cbc - dh hematology control for genrui kt 6610, probe cleaner 50 ml for gunuri automated, pt reagent kitof 25 tests, rapid card screening for hepatatis a hav 50test oblique kit, rapid card screening for hepatatis e hev50 test oblique kit, single blood collection bag 350ml, cellclean 1x50 ml
  • View Tender
  • Document
  • Bid Support
  • 1
  • 2
  • 3
  • 4
  • 5
  • Tenders Expired In - 2025
  • Tenders Expired In - 2024
  • Tenders Expired In - 2023
  • Tenders Expired In - 2022
  • Tenders Expired In - 2021
  • Tenders Expired In - 2020
  • Tenders Expired In - 2019
  • Tenders Expired In - 2018
  • Tenders Expired In - 2017
  • Tenders Expired In - 2016
  • Tenders Expired In - 2015
Related Sub Industries : Safety Equipment And Explosives
  • Seal Tenders ,
  • Arms And Ammunation Equipment Tenders ,
  • Protection Kit Tenders ,
  • Detector Tenders ,
  • Surveillance System Tenders ,
  • Fire Alarm System Tenders ,
  • Helmet Tenders ,
  • Cctv System Tenders ,
  • Fire Fighting System Tenders ,
  • Fire Detection System Tenders

Get Detector Tender Alert...

392491

Related Sub Industries : Safety Equipment And Explosives

  • Coating Tenders
  • Forging Item Tenders
  • Cotton Waste Tenders
  • Curtain Tenders
  • Stirrer Tenders
  • Mattress Tenders
  • Wall Tenders
  • Measurement System Tenders
  • Fire Alarm System Tenders
  • Dragline Tenders

Read More


Tender Document

509092

State Tenders »

  • Maharashtra Tenders
  • Delhi Tenders
  • West Bengal Tenders
  • Tamil Nadu Tenders
  • Andhra Pradesh Tenders

City Tenders »

  • Hyderabad Tenders
  • Visakhapatnam Tenders
  • Guwahati Tenders
  • Patna Tenders
  • Chandigarh Ut Tenders

Keyword Tenders »

  • Drainage System Tenders
  • Bore Well Tenders
  • Excavating Tenders
  • Wire Fence Tenders
  • Earth Filing Tenders

Sector Tenders »

  • Drugs And Pharmaceuticals Tenders
  • Survey Work Tenders
  • Shipping Transport Tenders
  • Scientific Research And Instruments Tenders
  • Security Services Tenders

Ownership Tenders »

  • Central Government And Public Sector Tenders
  • Co Operative Tenders
  • Corporations And Associations And Others Tenders
  • Private Sector Tenders
  • State Government Tenders

Indian Segment

  • State Tenders
  • City Tenders
  • Industry Tenders
  • SubIndustry Tenders
  • Sector Tenders
  • Ownership Tenders
  • Agency Tenders
  • Keyword Tenders
  • Source of Tenders

Browse Tenders

  • RFP-RFQ Tenders
  • Vender Registration Tenders
  • ICB Tenders
  • NCB Tenders
  • Auction Tenders
  • Corrigendum Tenders
  • E Procurement Tenders
  • GeM Tenders (Registration)

Global Segment

  • Middle East Countries Tenders
  • European Countries Tenders
  • African Countries Tenders
  • Asian Countries Tenders
  • Saar Countries Tenders
  • Australia Oceania Countries Tenders
  • South America Countries Tenders
  • North America Countries Tenders

Others

  • Services
  • Sitemap
  • About Us
  • Contact Us
  • Career
  • Tender Consultants
  • Terms & Conditions
  • Privacy & Policy

Get in touch with us

  • +91-92760 83333 (In India)
    +91-92743 15555 (South India)

  • sales@thetenders.in / ceo@thetenders.in

W B


Copyright ©2018 - Thetenders.com.

Download Mobile App