Notice Inviting Tender (NIT) by the Central Government And Public Sector Of India for
Supply of Consumables For Medical Research Thermo Sigma, 1132 Primer For Qrdr Gyraf5cgtcgtgttctttatggtgc3 20Mer Primer For Qrdr 20Mer Primer For Qrdr Parcf5tgggcttaaaacccaccact3 20Mer Primer For Qrdr Parcr5cgggtttctgtgtaacgcat3 20Mer Q32880 Qubit Microrna Assay Kit E6909 Ecm Gel From Engelbroth- Holm-Sworm Murine Sarcoma 5Ml M5655-500Mg Thiazolyl Blue Tetrazolium Bromide Mtt R8755 Rpmi 1640 Medium 10X1l Sml-0868-5Ml Purmorphamine Xnat2-1Kt Extract N-Amp Tissue Pcr Kit 100 Reactions Slgpr33rs P8920 Poly-L-Lysine Solution 0.1 Percent 100Ml 126658 Albumin Human Serum Fraction V High Purity 5G Sigma Oligonucleotides Desalt Dry Sigma Oligonucleotides Desalted Hplc Purified Biotynylated
in Mumbai - Maharashtra has been published.
The last date of this tender is 17/07/2024, work value is
416000 INR,
EMD is 0 (Refer Doc) INR
and tender document fees is
0 (Refer Doc) INR
For more details call us on +91 92760 83333 for bidding support this tender, GeM, vendor registration (if any) and tender BOQ documents.