Bidding Support

092633

Bidding Support

Warm Greetings from www.thetenders.com, the fastest growing tender information portal in India.

Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Sodium Carbonate 500 G , Thiobarbituric Acid 125 G , Sodium Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Sulfate Feso4 500 G , Sodium Hypochlorite Naocl 500 Ml , Perchloric Acid Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Sodium Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Sodium Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent Glutaraldehyde 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric Acid 1000 Ml , Perchloric Acid 1000 Ml , Glacial Acetic Acid 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric Acid 500 G , Sodium Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric Acid 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey Broth 500 G , Mha Muller Hinton Broth 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 Broth 500 G , Ox Bile Ox Gall 500 G , Mha Agar 500 G , Mrs Broth 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Lactose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient Broth 500 G

TRN :34278450
Central Government And Public Sector / Education And Research Institutes
Kangra - Himachal Pradesh

INDIAN Hire Our Expertise :

  • Tender Bidding
  • Tender Consultancy
  • Tender Advisory
  • Identify Eligibility Criteria
  • Identify Penelty Clauses
  • Highlight Important Dates
  • Technical Bid Preparation
  • Offline Bid Preparation
  • Online Bid Preparation
  • Offline Bid Submission
  • Online Bid Submission
  • Track Corrigendum / Addendums
  • Attend Pre Bid Meetings
  • Consistent Liaison & Coordination
  • EMD Follow Ups

INDIAN - bidding
image

We heartily welcome your move to excel your business to new heights.

Set Tender Alert

Activate daily alerts to know the tenders available of your work.

Get alerts

Bidding Support

Ask experts, how to fill bid forms, submit bids, participate in bids.

Get in touch

GeM Registration

Looking for GeM Registration? Get in touch with us and we will do the needful.

Registration

Digital Certificate

Get DSC for e-Tendering, e-Auction, e-bidding, Corporations / Associations / Others Tenders

Purchase now

Tender Awards

Want to know who's got the tender and are looking for subcontracting?

Connect now

Projects

Government and other private players, Real-time Updates of Project Information

Get info

International Tenders

We almost cover all the regions and countries across the world. Click to take your business to new heights.

Start now

Web Design

Get the Best Offers & Deals, expertise in developing static websites, dynamic websites and e-commerce.

Design now

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us

W B


Copyright ©2018 - Thetenders.com. Read Policies