Liasoning Service

750097

Liasoning Service

Warm Greetings from www.thetenders.com, the fastest growing tender information portal in India.

Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Sodium Carbonate 500 G , Thiobarbituric Acid 125 G , Sodium Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Sulfate Feso4 500 G , Sodium Hypochlorite Naocl 500 Ml , Perchloric Acid Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Sodium Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Sodium Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent Glutaraldehyde 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric Acid 1000 Ml , Perchloric Acid 1000 Ml , Glacial Acetic Acid 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric Acid 500 G , Sodium Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric Acid 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey Broth 500 G , Mha Muller Hinton Broth 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 Broth 500 G , Ox Bile Ox Gall 500 G , Mha Agar 500 G , Mrs Broth 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Lactose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient Broth 500 G

TRN :34278450
Central Government And Public Sector / Education And Research Institutes
Kangra - Himachal Pradesh

INDIAN Instructions for obtaining this information:
  1. If you are a registered member, please login in the members area with your user id and password.
  2. If you are not a registered member, then first register for the services.
  3. If you don’t want to register, but want to download only this project information, then fill in the form.
  4. Email id and mobile should be correct. www.thetenders.com will not be responsible for non receipt of the desired information at your end owing to wrong email id and mobile number.
  5. Upon filling this form follow the next instructions.
  6. You will receive the information and documents on the email id provided by you.
  7. In case of any query please call us on +91 92760 83333
INDIAN - Liason

Why www.thetenders.com ?

  • Fastest growing tender information portal in India
  • User friendly tender web portal with multiple search criteria
  • Reliable and quick tender information services
  • Reduces time, cost and man power required for tender cycle
  • Tenders information across India and Globe
  • Tenders categoried in various groups
  • Team, sprawling over entire Geography, scans various tenders and uploads them on our portal
  • Comprehensive and Sophisticated software to search online tenders
  • Search features by Product Keywords, Industries, States & Regions, Price, Organisation & Sectors etc.
  • Choose categories as per your choice
  • Daily alerts on emails about tenders of your category
  • Non English Tenders translated into English
  • 24 x 6 customer support with E-tendering support
  • Scanned copies of tender documents
  • Tenders from Government, Semi Government, Corporate Sector, Private Sector, PSUs, NGOs, state, city and local bodies
  • Download available tender documents.
  • Technical support for online and offline tenders including e-bidding, e-auction etc.
  • No hidden Cost / No Additional Charges / Quick service activation
  • Bid Form collection support
  • Bid Form filling support
  • Bid Form submission support
  • Provide SEO benefit for you site*
  • Available upcoming projects and Market research journals absolutely free.
  • Free 5 page website designing and hosting *
  • Provides platform to advertise your products daily through emails and reach the customer inbox directly. *
  • Tenders from newspapers
  • Tenders from websites

Set Tender Alert

Activate daily alerts to know the tenders available of your work.

Get alerts

Bidding Support

Ask experts, how to fill bid forms, submit bids, participate in bids.

Get in touch

GeM Registration

Looking for GeM Registration? Get in touch with us and we will do the needful.

Registration

Digital Certificate

Get DSC for e-Tendering, e-Auction, e-bidding, Corporations / Associations / Others Tenders

Purchase now

Tender Awards

Want to know who's got the tender and are looking for subcontracting?

Connect now

Projects

Government and other private players, Real-time Updates of Project Information

Get info

International Tenders

We almost cover all the regions and countries across the world. Click to take your business to new heights.

Start now

Web Design

Get the Best Offers & Deals, expertise in developing static websites, dynamic websites and e-commerce.

Design now