Thetenders.com
  +91 92760 83333 / +91 92743 15555
  • Indian Tenders
  • |
  • Global Tenders
  • |
  • Projects
  • |
  • Tender Awarded
  • |
  • Sub-Contractor
  • Pay Online
  • Register now
  • Login
  • Indian Tenders Tender information of India
  • Global Tenders International Tender information
  • Projects Project information of India
  • Tender Awarded Tender awarded information
  • Sub-Contractor Vendor information of India
  • Pay Online
  • Register now
  • Login
  • Contact Info All India : 9276083333 / 9274315555 South India : 9274315555
TheTenders
»
Indian Tenders
»
Industry Tenders
»
Air-Conditioners
Filters
  • » By Keywords
  • » By Cities
  • » By States
  • » By Agencies
  • » By Sectors
  • » By Ownerships
  • Tender Value

List of air-conditioners Tenders

List of latest air-conditioners Tenders in Indian Tenders. Click on any air-conditioners Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for air-conditioners Tenders.

Advance Search
  • All-Tenders (72)
  • |
  • Today's-Tenders
  • |
  • Active-Tenders
  • |
  • Closed-Tenders
51 Railway Transport
image image
Central Government/Public Sector
TRN :35629996 |  10 Nov, 2025
Tender Value : 1.75 Crore
 Abu Road - Rajasthan
Tender for repair and maintenance of roof mounted cab ac units during minor and major inspection schedule, one time repair and amc of hhp diesel loco cab ac at diesel shed abu road for a period of 02 years.
  • View Tender
  • Document
  • Bid Support
52 Railway Transport
image image
Central Government / Public Sector
TRN :35630306 |  11 Nov, 2025
Tender Value : 1.19 Crore
 Samastipur - Bihar
Tender for provision of supply, installation, testing and commissioning of precision ac of 2tr capacity and 2tr split ac at service building, s&t goomties in connection with sason-sarala3rd & 4th line, jarpada-budhapank3rd& 4th line, leftover stations/locations of salegaon-budhapank 3rd & 4th line and at bhubaneswar, sambalpur & angul unit of east coast railway.
  • View Tender
  • Document
  • Bid Support
53 Railway Transport
image image
Central Government / Public Sector
TRN :35630468 |  05 Nov, 2025
Tender Value : 62.07 Lacs
 Secunderabad - Telangana
Tender for gem bids for custom bid for services - annual maintenance of the airconditioning units and the water coolers of variouscapacities installed at various locations over secunderabaddivision for a period of 2 years
  • View Tender
  • Document
  • Bid Support
54 Security Services
image image
Central Government/Public Sector
TRN :35630957 |  05 Nov, 2025
Tender Value : 10.31 Lacs
 Ambala - Haryana
Tender for gem bids for bipp bismuth iodoform paraffin waste 10gm, corn cap 40percent sallicylic acid, benzocaine 20 percent pectin baseoral oint tube of 5gm, para dichlorbenzene 2 percentbenzocaine 2 point 7 percent chlorbutol 5 percent, dextrose 5 percent bott of 500 ml, ed hyaluronate sodium0 point 1 percent wv 5ml, ed hydroxypropyl methylcellulose 0 point 3 percent eye drop 10 ml, ed carboxymethyl cellulose 1 percent bott of 5 ml, pilocarpine nitrateeye solution 2 percent bott of 5 ml, nasal spray hypertonicsaline 110 ml, ed sodium chromoglycate 2 percent bott of10 ml, ed sulphacetamide 20 percent bott of 10 ml, respformoterol 20mcg plus budesonide 0 point 5mg, salmeterol 50 mcg plus fluticasone 125mg mdi120 doses, inh tiotropium bromide 9 mcg 120 metered doesunit, injdicyclomine hcl 20mg, inj levocarnitine 5mg, indomethacin 75mg sr cap, isotretinoin 10 mg cap, antibiotic ointment each gm containing polymyxin bsulphate 5000 units, clobetasole 0 point 05 percent plussalicylic acid 3 point 5 percent lotion 60ml, lot antisepticchlorhexidine gluconate 7 point 5 percent cetrimide 15 bottof 1 ltr, luliconazole 1 percent ung 30gm, ketaconazole 2percent salicyclic acid 2 percent lotion 60 ml, ketoconazole 2 percent plus piroctone oleamine 0 point 5percent shampoo 50 ml, sodium chloride 6 percent wwointment tube of 3 gm, ung clarithromycin 1 percent 15gm, lot clobetesal 0 point 05 percent salycyic acid 3 point5 percent bott of 30ml, lot coaltar 4 point 25 percent plussalycylic acid 2 percent bott of 100 ml, nasal spraybudesonide 100 mcg, tab adementionine 400 mg, tabalfalcidol vit d3 0 point 25 mcg, tab ambrisentan 5mg, tab amlodipine besylate 10 mg, tab cerebroproteinhydrolysate 90 mg, tab diacerine 50 mg, tab feropenumsodium 300 mg, tab mefenamic acid 250 mg plusdicyclomine hydrochloride 10 mg, tab montelukast 10 mgplus levocetirizine 5 mg, tab oxcarbamazepine 300 mg, tab rivastigmine 1 point 5 mg, tab ubidecarenone 180 mg, tab pentosan 100mg, tab tetrabenzine 25 mg, lotaluminium chloride 20 percent bott of 150 ml, tablevenorgesterol 0 point 25 mg plus ethinylestradiol 0 point05 mg pack of 21 tab, tab mefanamic acid 500mg plusdicyclomine 10 mg, tab norfloxacin 400 mg plus tinidazole500 mg
  • View Tender
  • Document
  • Bid Support
55 Railway Transport
image image
Central Government/Public Sector
TRN :35632952 |  10 Nov, 2025
Tender Value : 59.66 Lacs
 Rourkela - Orissa
Tender for repair and maintenance of roof mounted cab ac units for minor inspection and major schedule of 3 phase locomotives at els/rou, for a period of 02 years.
  • View Tender
  • Document
  • Bid Support
56 Panchayat Division
image image
State Government
TRN :35637290 |  06 Nov, 2025
Tender Value : 3.42 Lacs
 Dinajpur - West Bengal
Tender for installation of solar street light at different pin pointed places14 units at chakvagirath sansad under ramchandrapur gram panchayat. activity nit-12, sl-2
  • View Tender
  • Document
  • Bid Support
57 Security Services
image image
Central Government/Public Sector
TRN :35620836 |  03 Nov, 2025
Tender Value : 0
 Bangalore - Karnataka
Tender for gem bids for custom bid for services - camc for ac units /
  • View Tender
  • Document
  • Bid Support
58 Telecommunication Services And Equipments
image image
Central Government / Public Sector
TRN :35626218 |  04 Nov, 2025
Tender Value : 12.35 Lacs
 Ahmedabad - Gujarat
Tender for gem bids for comp, cm of 1.5tr non inverter split ac units, cm of 2 tr noninverter split ac units, cm of 2 x 1.5tr hsac units, replace pcb indoor unit inverter split ac units, replacepcb outdoor unit inverter split ac units
  • View Tender
  • Document
  • Bid Support
59 Education And Research Institutes
image image
Central Government/Public Sector
TRN :35610475 |  03 Nov, 2025
Tender Value : 16.98 Lacs
 Nainital - Uttaranchal
Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5
  • View Tender
  • Document
  • Bid Support
60 Air Transport
image image
Central Government/Public Sector
TRN :35611902 |  01 Nov, 2025
Tender Value : 1.99 Crore
 Panaji - Goa
Tender for gem bids for supply of vrv modular type ac - outdoor unit 20 hp, supply of ceiling mounted cassette type vrv -indoor unit3.2 tr, supply of ceiling mounted cassette type vrv -indoor unit 4.48 tr, cordless remote for cassette typeunits, supply of refnet joints for branching of refrigerant, multiconnecting kit for outdoor unit, itc of modular typeoutdoor units ac - 20 hp, itc of ceiling mounted cassettetype intdoor units ac - 3.2 tr, itc of ceiling mountedcassette type intdoor units ac - 4.48 tr, itc of refnetjoints for branching of refrigerant piping, sitc of copperrefrigerant piping thickness piping 9.5mm, sitc of copperrefrigerant piping thickness piping 12.7mm, sitc of copperrefrigerant piping thickness piping 15.9mm, sitc of copperrefrigerant piping thickness piping 19.1mm, sitc of copperrefrigerant piping thickness piping 22.2mm, sitc of copperrefrigerant piping thickness piping 28.6mm, sitc of copperrefrigerant piping thickness piping 34.9mm, sitc of copperrefrigerant piping thickness piping 38.1mm, sitc of copperrefrigerant piping thickness piping 41.3mm, sitc of powercommunication cable of 2cx 1.5 sqm cable in pvc conduit., sitc of pvc piping, wrapped with nitrile rubber insulation6mm thickness- 25 mm dia, sitc of pvc piping, wrappedwith nitrile rubber insulation 6mm thickness 50 mm dia, sitc of ms frame work for outdoor unit with necessarysupports., supply and installation of additional gas chargingfor vrv refrigerant, design, manufacture, sitc of outdoordouble door feeder pillar panel, supply of 4c x 10sqmmsize xlpe insulated pvc sheathed copper armoured cable, laying and fixing of pvc insulated and pvc sheathed upto35 sq.mm cable, laying and fixing of pvc insulated andpvc sheathed above 185 and upto 400 sq.mm cable, supply and making end termination with brass copressiongland - 4c x 10 sqmm, supply and making end terminationwith brass copression gland - 3.5c x 300 sqmm, supply andfixing 6 amps to 32 amps 240 415v c curve single pole mcb, supply and fixing 8 way 4 plus 24, double door tpnhorizontal db, supply and fixing 100 amps 415v, 10ka ccurve miniature circuit breaker, wiring for circuit submainwiring alongwith earth wire 4 x 2.5 sq.mm plus 2x2.5 sqmm, supplying and fixing 25mm sizes of steel conduit, supplying and fixing 2 module 75mm x 75mm gi box, supplying and fixing 6 pin 15 16 amps socket, supplyingand installing 300mm x 50mm x 1.6mm hot dippedperforated iron cable tray
  • View Tender
  • Document
  • Bid Support
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • 7
  • 8
  • Tenders Expired In - 2025
  • Tenders Expired In - 2024
  • Tenders Expired In - 2023
  • Tenders Expired In - 2022
  • Tenders Expired In - 2021
  • Tenders Expired In - 2020
  • Tenders Expired In - 2019
  • Tenders Expired In - 2018
  • Tenders Expired In - 2017
  • Tenders Expired In - 2016
  • Tenders Expired In - 2015
Search Other Industries
  • Storage And Warehousing Tenders ,
  • Other Metal Products Tenders ,
  • Fencing And Wall Work Tenders ,
  • Roads Tenders ,
  • Bridges Tenders ,
  • Desilting Tenders ,
  • Security Services Tenders ,
  • Water Purification Tenders ,
  • Building Material Tenders ,
  • Ball Bearings Tenders

Get Air Conditioners Tender Alert...

237631

Search Other Industries

  • Storage And Warehousing Tenders
  • Other Metal Products Tenders
  • Fencing And Wall Work Tenders
  • Roads Tenders
  • Bridges Tenders
  • Desilting Tenders
  • Security Services Tenders
  • Water Purification Tenders
  • Building Material Tenders
  • Ball Bearings Tenders

Read More


Tender Document

172912

State Tenders »

  • Maharashtra Tenders
  • Delhi Tenders
  • West Bengal Tenders
  • Tamil Nadu Tenders
  • Andhra Pradesh Tenders

City Tenders »

  • Hyderabad Tenders
  • Visakhapatnam Tenders
  • Guwahati Tenders
  • Patna Tenders
  • Chandigarh Ut Tenders

Keyword Tenders »

  • Tiles Work Tenders
  • Acoustic Work Tenders
  • Slab Flooring Tenders
  • Infrastructures Work Tenders
  • Drilling Tenders

Sector Tenders »

  • Drugs And Pharmaceuticals Tenders
  • Survey Work Tenders
  • Shipping Transport Tenders
  • Scientific Research And Instruments Tenders
  • Security Services Tenders

Ownership Tenders »

  • Central Government And Public Sector Tenders
  • Co Operative Tenders
  • Corporations And Associations And Others Tenders
  • Private Sector Tenders
  • State Government Tenders

Indian Segment

  • State Tenders
  • City Tenders
  • Industry Tenders
  • SubIndustry Tenders
  • Sector Tenders
  • Ownership Tenders
  • Agency Tenders
  • Keyword Tenders
  • Source of Tenders

Browse Tenders

  • RFP-RFQ Tenders
  • Vender Registration Tenders
  • ICB Tenders
  • NCB Tenders
  • Auction Tenders
  • Corrigendum Tenders
  • E Procurement Tenders
  • GeM Tenders (Registration)

Global Segment

  • Middle East Countries Tenders
  • European Countries Tenders
  • African Countries Tenders
  • Asian Countries Tenders
  • Saar Countries Tenders
  • Australia Oceania Countries Tenders
  • South America Countries Tenders
  • North America Countries Tenders

Others

  • Services
  • Sitemap
  • About Us
  • Contact Us
  • Career
  • Tender Consultants
  • Terms & Conditions
  • Privacy & Policy

Get in touch with us

  • +91-92760 83333 (In India)
    +91-92743 15555 (South India)

  • sales@thetenders.com

W B


Copyright ©2018 - Thetenders.com.

Download Mobile App