Filters

List of clip-file Tenders

List of latest clip-file Tenders in Indian Tenders. Click on any clip-file Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for clip-file Tenders.

All-Tenders (539)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Corporations / Associations / Others

TRN :35609090 | 17 Oct, 2025

Tender Value : 8.20 Lacs

Tambaram - Tamil Nadu

Tender for formation of cc road at brindhavan nagar extn 4th cross street in counselor fund at division 04, unit -01, zone-1 z.o.1.c.no.b1/03490/2025

Central Government/Public Sector

TRN :35609424 | 21 Oct, 2025

Tender Value : 0

Kota - Rajasthan

Tender for gem bids for echs, cough lozenges cremaffin liquid paraffin 125mgmagnesium hydroxide 375mg sodium picosulphate33mg 170 ml syp cyproterone 2mg ethinylestradiol 0035mg tab dabigatran 150 mg tab daflon 500mg diosmin 450mg hesperidin 50mg tab dapagliflozin 10 mg tab deflazacort 6 mg tab desensitising paste stannous fluoride or potassiumnitrate or sod monofluorophosphate tube of 50gm desvenlafaxine 50 mg tab diacerein 50 mg tab diclofenac 50 mg paracetamol 325 mg tab diclofenac 50 mg serratiopeptidase 10 mg tab diclofenac gel 1 percent diclofenac spray bottleof 40 gm dicyclomine 10mg mefenamic acid 250mgtab digoxin 025 mg tab diltiazem 60 mg tab diltiazem 90mg sr tab disodium hydrogen citratesyrup divalproex 500 mg tab domperidone 10 mgtab donepezil 5 mg tab donepezil 5mg memantine10mg tab dorzolamide 2 percent timolol 05percent eye drop doxophylline 400 mg tab doxycycline 100mg cap dressing sterile adhesive drotaverine 80 mg tab duloxetine 20mg cap eardrop chloramphenicol 5 percent clotrimazole 1percent betamethasone 025 percent lignocaine hcl2 percent in bottle of 5 ml ed ciprofloxacin 03percent ed loteprednol 05 percent moxiflox 05percent ed moxifloxacin and dexamethasone ednepafenac 01percent empagliflozin 10mg tab eplerenone 25 mg tab escitalopram 10 mgclonazepam 05 mg escitalopram 10mg tab esomeprazole 40 mg tab etizolam 05mg tab etodolac 400 mg tab etophyllin 115 mg thiophyllin35 mg sr 150 mg tab etoricoxcib 90mg tab etoricoxib 60 mg tab evening promrose 1000 cap bid number gem2025b6737084 dated 11-10-2025 bid document1 86 0 0 eye drop tobramycin0.3 percent 5 ml, ezetimibe 10mg tab, faropenem sodium 200 mg tab, febuxostat40mg tab, fenofibrate 145 mg tab, fenofibrate 200mg tab, ferrous fumarate folic acid tab or cap, fexofenadine 120 mg montelukast 10mg tab, fexofenadine 120mg tab, fluconazole 150 mg capor tab, flunarizine 10 mg tab, fluoxetine 20mg tab, flupentixol 0.5 mg melitracen 10 mg tab, folicacid 5 mg tab, formoterol 12mcg budesonide400mcg rotacap, formoterol 6mcg budesonide200mcg rc, formoterol 6mcg budesonide 400mcgrotacap, fourderm cream chlorhexidinegluconate 0.20 percent, clobetasol topical 0.05percent, miconazole topical 2 percent neomycintopical 0.5 percent 30 gm, framycetin sulphatecream bp 1 percent cream 15 or 20 gms, frusemide20 mg spironolactone 50 mg tab, frusemide 40 mgtab, fusidic acid oint orcream 15 gm, gabapentin100mg tab, gabapentin 300 mg methylcobalamin 500mg tab, gabapentin 300mg tab or cap, gammabenzene hexachloride 1 percent cetrimide 0.1percent lotion 100ml, ginkgo biloba tab, gliclazide 60 mg mr tab, glimepiride 2 mg metformin500 mg sustained release tab, glimepride 1 mgmetformin 500 mg tab, glimipride 1 mg metformin500 mg piog 15mg tab, glucosamine 500 mgchondriotin 400 mg tab, glucosamine 500 mg tab, glucosamine 750 mg diacerine 50 mg msm 200 mg tab, glucosamine sulphate 750mg metyulsulphonylmethaone 200mg oxydents and minerals, glucose powder, glutathione 500 mg tab, glycerylnitrate 2.6 tab, glyceryl nitrate 6.4 tab, gum paint15 ml, hydrochlorothiazide 12.5 mg tab, hydroxychloroquine 200 mg tab, hydroxyzine 25mg tab, imatinib 400 mg cap, indapamide sr 1.5 mgtab, indomethacin 75mg cap, inh budesonide 200mcg, inh ipratropium bromide 20mcglevosalbutamol 50 mcg mdi, inj cefotaxime sodium 1gm, inj ceftriaxone 1 gm, inj diclofenac 25mg perml 3ml, inj iron sucrose, inj methylcobalamin1000mcg vitamin b6 pyridoxine 100mgnicotinamide100mg, inj methylcobalamin 1500 mcg, inj rabipur vaccine 1 ml, insulin actrapid 100 iu perml, 3 ml pen, insulin highly purified isophane humannph 40iu per ml, 10 ml inj, insulin humalog lispro injrecombinan dna origin 100iu per ml cartidge, insulin premixed biphasic a 40 iu per ml 30 percenthuman neutral plus 70 percent human isophaneinsulin 10 ml inj, isabgol or ispaghula husk 3.5 gm, isosorbid mononitrate 20 mg tab, isosorbidedinitrate 10 mg tab, isosorbide dinitrate 5 mg tab, isosorbide mononitrate 30mg tab, isotonicglusose saline 500 mlcough lozenges, cremaffin 170ml syp, cyproterone2mg + ethinyl estradiol 0.035mg diane 35 tab, dabigatran 150 mg tab, daflon 500mg diosmin450mg + hesperidin 50mg tab, dapagliflozin 10 mgtab, deflazacort 6 mg tab, desensitising pastestannous fluoride/potassium nitrat tube of 50gm, desvenlafaxine 50 mg tab, diacerein 50 mg tab, diclofenac 50 mg + paracetamol 325 mg tab, diclofenac 50 mg + serratiopeptidase 10 mg tab, diclofenac gel 1% voveran , diclofenac spraybottle of 40 gm, dicyclomine 10mg + mefenamicacid 250mg tab, digoxin 0.25 mg tab, diltiazem 60 //bid details2 / 86

State Government

TRN :35609515 | 17 Oct, 2025

Tender Value : 0

Karur - Tamil Nadu

Tender for procurement of office waste paper white records in bale form from andhrapradesh/ telangana on for kagithapuram basis procurement of office waste paper white records in bale form from andhrapradesh/telangana

Central Government/Public Sector

TRN :35609584 | 23 Oct, 2025

Tender Value : 0

Agra - Uttar Pradesh

Tender for supply of formoterol 6 mcg + glycopyrrolate 25 mcg rotacaps 01 free rotahaler along with 150 rotacaps item no. 2712 of ami 2025-26

State Government

TRN :35609868 | 17 Oct, 2025

Tender Value : 0

Karur - Tamil Nadu

Tender for procurement of office waste paper white records in loose form from kerala on for kagithapuram basis procurement of office waste paper white records in loose form from kerala

Central Government/Public Sector

TRN :35610002 | 24 Oct, 2025

Tender Value : 0

Bangalore - Karnataka

Tender for supply of formoterol 6mcg with tiotropium 9mcg per md of not less than 120mdi inhaler.

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Central Government / Public Sector

TRN :35610591 | 20 Oct, 2025

Tender Value : 0

Khurda - Orissa

Tender for supply of respule formeterol+ budesonide, 20 mcg + 0.5 mg

Central Government/Public Sector

TRN :35610698 | 23 Oct, 2025

Tender Value : 0

Pune - Maharashtra

Tender for gem bids for overhead architectural ambience modules, wall mountedfeature accents, central signature suspended forms 4 feetdiameter, contemporary air circulation installations, integrated control interfaces in brushed metal, concealedservicer routing and terminations, fluted column wrapswith integrated dining modules, column adjacent coriantop service stations, extended banquet service tables 15ft by 4 ft, round communal dining modules 8ft, decorative wall relief mouldings, freestanding spatialdividers, precision-cut feature installations with embeddedillumination, dual surface service counter in laminate andstone finish, framed glass access portals 6 ft by 7ft, integrated entry conditioning systems with concealedcanopy, air curtains, modular suspended framework, seamless monolithic planes, contoured feature ceiling insculpted finish, dual -tone reflective surface treatment formain hall, artistically finished feature panels, highdurability surface finish for transitional areas, interactivetabletop challenge consoles, high velocity airfloerecreation surface, ergonomic seating modules

Central Government/Public Sector

TRN :35611055 | 22 Oct, 2025

Tender Value : 0

Rajouri - Jammu And Kashmir

Tender for gem bids for the inside store of russias bloody war and ukraines fight of survival by luke harding , putins wars form chechnya to ukraine by mark galeotti , likewar the weaponizatin of social media by pw singer emerson brooking , ghost fleet a novel of the next world war , introduction of psychology by james w kalat , power of now by eckhart tolle , swarm troopers , parva by s l bhyrappa , carvalho by purnschandra tejswi , heli hogu kaarana by ravi belagere , bhagavadgita by srila prabhupada , chhatrapati shivaji , marali mannige , karnataka history by binayaka anthavally , mankuthimman kagga , mukajjya kanasugalu , tenali raman kathegalu , kavi rajya marga , general knowledge book kannada , ponniyin selvan by kalki krishnamurthy , panchatantra stories by arulmigu amman p , nexus , dr br ambedkar , ramayanam by valmiki , psychology of money , tenali ramakrishna by tadanki v l n r , prajal manasi , atomic habits , palnati veera charitra , thimmiri billalu thoda pasalu , barrister parvateesam , chiveriki migiledi , alpajivi , kalatheetha vyakthulu , india that is bharat , ramayana teluge , randamoozham by mt vasudevan nair , mathilukal by vaikom muhammad basheer , balykalasakhi , panchatanatram , pathummayude aadu by vaikom muhd basheer , winks of fire , ramayana malayalam , chanikya neeti , agani pankh , shyamchi aai , gnyanayog , rajyayog , karmyog , bhakthiyog , army of none autonomous weapons and the future of war , artificial intelligence and the future of warfare , vedh mahamanavacha , the power of passion and perseverance , the psychology of persuasion , the power of thinking without thinking , thinking fast and slow , the laws of human nature , the mountains is you , the art of thinking clearly , when things dont go your way , a new earth , enlighment , the alchemist , intelligent investor , the mitrokhin archive i , autobiography of a yogi , how to enjoy your life and your job , riches are your right , you can , the mitrokhin archive ii

Related Searched Keywords : clip file

List of clip-file Tenders

Tender for formation of cc road at brindhavan nagar extn 4th cross street in counselor fund at division 04, unit -01, zone-1 z.o.1.c.no.b1/03490/2025

Tender for procurement of office waste paper white records in bale form from andhrapradesh/ telangana on for kagithapuram basis procurement of office waste paper white records in bale form from andhrapradesh/telangana

Tender for supply of formoterol 6 mcg + glycopyrrolate 25 mcg rotacaps 01 free rotahaler along with 150 rotacaps item no. 2712 of ami 2025-26

Tender for procurement of office waste paper white records in loose form from kerala on for kagithapuram basis procurement of office waste paper white records in loose form from kerala

Tender for supply of formoterol 6mcg with tiotropium 9mcg per md of not less than 120mdi inhaler.

Tender for supply of respule formeterol+ budesonide, 20 mcg + 0.5 mg

Get clip file Tender Alert...

Related Searched Keywords : clip file

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us