Indian Tenders Tender information of India
Global Tenders International Tender information
Projects Project information of India
Tender Awarded Tender awarded information
Sub-Contractor Vendor information of India
Pay Online
Register now
Login
Contact Info All India : 9276083333 / 9274315555 South India : 9274315555

Filters

List of glucose-kit Tenders

List of latest glucose-kit Tenders in Indian Tenders. Click on any glucose-kit Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for glucose-kit Tenders.

All-Tenders (30)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government/Public Sector

TRN :35608251 | 25 Oct, 2025

Tender Value : 28.94 Lacs

Agra - Uttar Pradesh

Tender for gem bids for mh, ibuprofen 200 mg tab, povidone iodine 10percent solutionbott of 100 ml, tinidazole 500 mg tab, paracetamol 325mg plus diclofenac sodium 50 mg tab, roxithromycin 150mg tab, albendazole 400 mg tab, ofloxacin 400 mg tab, losartan 25 mg tab, losartan 50 mg tab, diclofenac 25mgperml ip 3 ml inj, ibuprofen 400 mg tab, aceclofenac100 mg tab, levofloxacin ip 250 mg tab, ciprofloxacin500 mg plus tinidazole 600 mg tab, fluconazole 150 mgcappertab, inj cefoperazone 500 mgplus sulbactum 500mg vial, inj benzathine penicillin 12 00 000 i.u. vial, povidone iodine 5percent ointment 250 gm jar, ranitidine150 mg tab, vitamin b complex with a minimumconcentration of vit b1-5mg vit b6-3mg and vit b12-5mcgtherapeutic tabpercap, diclofenac gel 1percent tube of 30gm, amikacin sulphate 250 mgper2 ml inj, cefotaximesodium 1gm inj, ceftazidime 1 gm inj, ceftriaxone 1 gm inj, cefuroxime 250 mg tab, cefixime 100 mg tab, doxycycline cap 100mg, gentamycin sulphate inj imperiv40mgperml 2 ml inj, azithromycin 500 mg tab, meropenem 500 mg inj, inj amikacin sulphate 250mgperml, adhesive plaster zinc oxide 2.5cm x 1mtr, bandage triangular, compression elastic bandage for dvtsmall, compression elastic bandage for dvt medium, compression elastic bandage for dvt large, lint absorbentcotton, adjustable arm pouch sling large medium andsmall, foleys balloon catheter 2 way silicon 16g, foley surinary catheter siliconeperantibacterial coated 3 way size-14, foley s urinary catheter siliconeperantibacterialcoated 3 way size -16, foley s urinary cathetersiliconeperantibacterial coated 3 way size -18, glucostripsone touch select bott 50 tripsferopenem 200mg tab, flupentiol 0.5mg + melitrxcen 10mgtab, flupirtine 100 mg er tab, fungal diastase 50 mg tab, /bid number: gem/2025/b/6741185* /dated: 11-10-2025 & & / bid document1 / 59 ginko biloba 120mg tab, gliclazide 80 mg tab, glimepride2mg + metformine 500 mg tab, glimepride 1mg +metformine 500 mg tab, glimepride 2mg + metformine sr1gm tab, glucosamine 500mg + diacerin 50mg tab, glycopyrolate 2 mg tab, iguratimod 25 mg tab, imipramine25 mg tab, lacosamide 100 mg tab, lacosamide 200 mgtab, lacosamide 50 mg tab, levetiracetam 250 mg tab, linagliptin 2.5 mg +metformin 1000 mg tab, linagliptin 2.5mg +metformin 500 mg tab, loratidine 10 mg tab, mebeverine 200 mg tab, megesterol acetate 80 mg tab, melalatonin 3 mg tab, mesalamine 1.2 gm tab, methylcobalamin 500 mcg tab, methylprednisolone 8 mgtab, mifenamic acid 250mg + tranexamic acid 500mg tab, moxonidine 0.2 mg tab, moxonidine 0.3 mg tab, nifedipine10 mg sr tab, nifedipine r 20 mg tab, nitroglycerine 6.4 mgtab, olmisartan 40mg + hydrochlorthiazide 12.5 mg tab, posaconazole 100 mg tab, rifaximine 400 mg tab, rosuvastatin 10 mg tab, rosuvastatin 40 mg tab, safinamide 50mg tab, selegilne 05 mg tab, serratiopeptidase 10 mg tab, simvastatin 10 mg tab, sitagliptin phosphate 50 mg tab, sofosbuvir 400 mg +velpatasavir 100 mg tab, tenilgliptin 20 mg tab, tenilgliptin20 mg+metformin 500 mg tab, tenofovir 300 mg +ajenamide 25 mg tab, thiocolchicoside 4 mg tab, tizanidine2 mg tab, tolperisone hcl 150 mg tab, topentadol 50 mgtab, torsemide 10 mg+spironolactone 25 mg tab, torsemide 20 mg tab, trifluoperazine 05 mg tab, trifluoperazine 05 mg +trihexiphenidyl 02 mg tab, ubiquinol 100 mg tab, vilazodone 20mg tab, tacrolimus0.1% w/w tacvido forte oint 20gm, trypsin 96mg+bromelain 180mg + rutoside trihydrate 200mg tab, ungacyclovir skin 5 % w/w tube of 5 gm, collagen peptide 40mg + sodium hyaluronate 30 mg tab, glucostrips foraccucheck active bott of 50 strips, hydrochlorothiazide 12.5mg tab, eye gel hydroxypropyle methyl cellulose 0.3% w/wbott of 10ml, megestrol acetate 160 mg tab, vit b121500mcg + alpha 100mg + myo 100mg + fa 1.5mg +selen 55mcg cap, naproxen 500 mg tab, nebivolol 2.5 mgtab, neomercazole carbimazole 10mg tab, neomycin+beclometahsone +clotrimazole e/d 5 ml, nepafenac0.3%w/v 5 ml ed, nitroglycerin 2.6mg tab, ointbeclomethasone + salicylic acid 20 gm tube, olanzapine 2.5mg tab, pancreatin 10000 iu tab, piracetam 400 mg tab, pregabalin 75 mg + nortriptyline 25 mg tab, rosuvastin 10mg + aspirin 75 mg +clopidogril 75 mg tab, rotacapfluticasone 100mcg + salmetrol 50mcg / dose, saxagliptin2.5 mg tab, serrratiopeptidase 5 mg tab, sertraline 25 mgtab, silodosin 4 mg + dutasteroide 0.5 mg tab, silodosin 8mg + dutasteroide 0.5 mg tab, silymarin 70 mg tab, sodium valproate 300 mg cr tab, sodium valproate500mg tab, spironocatone 25 mg +frusemide 20 mg tab, spironolactone 50 mg tab, syrup iron + folic acid bott of200 ml, sgpt kit of 5 x 20 ml, sgot kit of 5 x 20 ml, glucose test kit 2 x 200 ml, blood urea reagent 1 2x60ml& reagent 2 60ml, bilirubin total + direct reagent 1 2x60micro ltr and reagent 2 2x60 micro ltr, uric acid kit of 5x20micro ltr, serum creatinine, reagent 1 2x60ml reagent 22x60ml, triglycerids kit of 5x20 micro ltr, cholesterol kitof 5 x 20 ml, urine sugar strips, each bottle of 100 strips, typhidot box of 50 test, total protein kit of 5x50ml, alkalinephosphate kit of 10x2.2 micro ltr, calcium kit of 5 x 20micro ltr, albumin kit of 5 x 50 ml, widal kit of 5ml x 4, rafactor kit of 50 test, adhesive plaster, zinc oxide, 2.5cm x1mtr, trioxsalen 25 mg tab, valacyclovir hydrochloride 500 //bid details2 / 59

Central Government/Public Sector

TRN :35608290 | 21 Oct, 2025

Tender Value : 0

Sonitpur - Assam

Tender for gem bids for erba multical xl kit system pack for em 360 , erba norm kit control system pack for em 360 , erba path kit control system pack for em 360 , erba wash kit system pack for em 360 , erba cholestrol kit system pack for em 360 , erba albumin kit system pack for em 360 , erba glucose kit system pack for em 360 , erba alp kit system pack for em 360 , pm kit for erba chem 5x

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Central Government/Public Sector

TRN :35615140 | 23 Oct, 2025

Tender Value : 16.68 Lacs

Rampur Up - Uttar Pradesh

Tender for gem bids for dglp, bid number gem2025b6729350 dated 13-10-2025 bid document1 50 1 1 eppendrof tube 0.5 ml plastic pkt of 100, sample cupsystem pack for em 200 pkt of 500, xl - multical systempack for em 200 4 x 3 ml, autowash system pack forem 200 10 x 100 ml, urea system pack for em 200 5 x44 ml oblique 5 x 11 ml, xl autowash ac oblique al kitsystem pack for em 200 5 x 44 ml oblique 5 x 44 ml, control reagents for em 200 normal oblique norm 1 x 5ml, control reagents for em 200 high oblique path 1 x 5ml, creatinine - enzymatic system pack for em 200 5 x30 ml 5 x 10 ml, cholesterol system pack for em 200 10x 44 ml, triglyceride system pack for em 200 5 x 44 mloblique 5 x 11 ml, direct hdl system pack for em 200 4x 30 ml oblique 4 x 10 ml, uric acid system pack for em200 5 x 44 ml oblique 5 x 11 ml, bilirubin total systempack for em 200 6 x 44 ml 6 x 12.3 ml, bilirubin directsystem pack for em 200 6 x 44 ml oblique 6 x 12.3 ml, sgot - el system pack for em 200 6 x 44 ml oblique 6 x12.3 ml, sgpt - e system pack for em 200 6 x 44 mloblique 6 x 12.3 ml, alkaline phosphatase system packfor em 200 2 x 44 ml oblique 2 x 11 ml, amylase systempack for em 200 5 x 22 ml, lipase xl system pack forem 200 1 x 44 ml oblique 1 x 11 ml, ldh - p system packfor em 200 2 x 44 ml oblique 2 x 11 ml, ggt systempack for em 200 2 x 44 ml 2 x 11 ml, ckmb system packfor em 200 2 x 12 ml oblique 2 x 3 ml, cknac systempack for em 200 2 x 12 ml 2 x 3 ml, calcium a systempack for em 200 5 x 6 ml, magnesium system pack forem 200 2 x 44 ml, phosphorous system pack for em 2005 x 6 m, xl crp with calibrator system pack for em 2002 x 22 ml oblique 1 x 11 ml, contro h aso oblique rfoblique crp system pack for em 200 1 x 1 ml, contro laso oblique rf oblique crp system pack for em 200 1 x1 ml, hba1c with calibarator system pack for em 200 2 x15 ml oblique 2 x 5 ml oblique 5 x 0.5 ml, hba1c con hsystem pack for em 200 1 x 0.5 ml, hba1c con lsystem pack for em 200 1 x 0.5 m, ec cartridge s 250tfor ec 90 - next generation electrolyte analyser, ec 90urine diluent 1x100ml for ec 90 - next generationelectrolyte, diluent 20 ltrs for genrui automatedhematology analyser, l h lyse 200 ml for genruiautomated hematology analyser, diff lyse 500 ml forgenrui automated hematology analyser, cell clean, stromatolyser, h pylori detection rapid test kit, chikengunai detection rapid test kit, kit for estimation of cpk cknac 2x8 oblique 2x2 ml, kit for estimation of ck - mb 2x8obliuqe 2x2 ml, paracheck for pv or pf kit of 50 falcivax, rapid card screening for hbsag 50 test oblique kit, stripsalbumin and glucose bottle of 100 strips, d - dimer kit 25assay quantitative for sami auto analyser, c reactiveprotein kit for 50 tests, pap stain kit, disposable pap smearkit pack of 50 kits, typhi dot test kit 30 test oblique kit, dengue test kit 10 test oblique kit, leishmans stainrtu bottle of 500 ml, reticulocyte stain rtu bottle of 500ml, glucose god - pod system pack for em 200 10 x 44ml, cbc - dh hematology control for genrui kt 6610, probe cleaner 50 ml for gunuri automated, pt reagent kitof 25 tests, rapid card screening for hepatatis a hav 50test oblique kit, rapid card screening for hepatatis e hev50 test oblique kit, single blood collection bag 350ml, cellclean 1x50 ml

Central Government/Public Sector

TRN :35606421 | 06 Nov, 2025

Tender Value : 15.00 Lacs

Aizwal - Mizoram

Tender for gem bids for chemicals, bid number gem2025b6781711 dated 13-10-2025 bid document1 75 1 1 dichlorophenol indophenols, 3 2 dinitrosalicyclic acid, anthrone, ascorbic acid, infusion agar, cetrimid aga, cetrimide ar, chlorine grnules, depc treated water, diphenylamine, disodium edta, dna, edta disodium, enriched thioglycollate, hydrochloric acid, l arginine, laspartic acid, leucine, lithium chloride, l-proline, orcinolmonohydrate, oxalate, oxalic acid, phenol crystals, piperacillin, rennin, rna, rotheras, sodium carbonate, sodium hydroxide pellets, sodium laureth sulfate, stannous chloride, trisbase, 2 mercaptoethanol, sodiumcitrate, absolute alcohol, albert metachromatic stain kit, alpha feto protein, biuret reagent, carcino embryonicantigen, cholesterol kit, ctab extraction solution, denguecombo, dnase 1 solution, erba triglycerides, esbl, ethylene glycol, fluoride solution, follicle stimulatinghormone fsh, indian ink, leutinisinghormone lh, bilirubin direct, bilirubin total, cholesterol, creatininereagent, glucose mono reagent, hdl direct reagent, ldldirect reagent, potassium reagent, sgot reagent, sgptreagent, triglycerides reagent, urea reagent, uric acidreagent, masson trichrome stain kit, muccarmine stainsolutionotto chem, n hexane, perchloric acid, phenolchloroform, povidone- iodine solution, prolactin, prostratespecific antigen, rapid h e stain kit, rapid oil red ostaining kit, pearl stain kit, ribonuclease, stainingsolution, siver nitratelabogen, sodium hypobromitesolution, sodium hypochlorite, sulfuric acid ar, sulphuricacid ar, te buffer, testosterone, thyroid stimulatinghormone, trizol reagent, universal ph indicator solution, van gieson staining kit, zn stain kit, amoxyclav, asotest kit, bacitracin disc, capsule staining kit, cefadroxil, cefepime disc, cefixime clavulanic aicd, cefotaxime disc, clavulanic acid, cefoxitin disc, cefpodoxime disc, ceftazidime, ceftriaxone disc, cephalexin, ciprofloxacin, cotrimoxazole, crp test kit, distilled water, gas pack, hav igg igm rapid test, hbsag rapid test kit, hcv abrapid test, hcv tridot test kit, hepatitis a rapid test kit, hepatitis e rapid test kit, hev igm rapid test, hiv tridotkest kit, imipenem, nitrofurantoin, norfloxacin, novobiocin disc, ofloxacin, optochin, piperacillintazobactem, pregnancy test kit, ra test kit, rf test kit, scrub typhus test kit, tetracycline, vdrl test kit, widaltest kit

Central Government/Public Sector

TRN :35607683 | 28 Oct, 2025

Tender Value : 10.26 Lacs

New Delhi - Delhi

Tender for gem bids for micro tips pp autoclavable 0 point 2 to 10ul 1000 per pkt, micro tips pp autoclavable 2 to 200ul 1000 per pkt, microtips pp autoclavable 200 ul to1000ul 500 per pkt, tissueculture petridish to sterile ps 100mm pkt of 200, tissueculture petridish to sterile ps 60mm pkt of 500, tissueculture petridish to sterile ps 35mm pkt of 500, tissueculture flask with filter cap sterile ps25cm pkt of 200, tissue culture flask with filter cap sterile ps75cm pkt of100, centrifuge tube conical bottom pp autoclavable 50sterile pkt of 500, centrifuge tube conical bottom ppautoclavable 15 sterile pkt of 500, tissue culture platesterile ps12 wells pkt of 50, tissue culture plate sterile ps6 wells pkt of 50, reagent bottle narrow mouth with screwcap bott of 100ml, reagent bottle narrow mouth withscrew cap bott of 250ml, reagent bottle narrow mouth withscrew cap bott of 1000ml, fetal bovine serum usa originsterile to filtered suitable for cell culture suitable forhybridoma bott of 500ml, collagenase from clostridiumhistolyticum pkt of 1gram, dispase ii 1gram, penicillinstreptomycin solution hybrid max tm bott of 100ml, mescosteogenesis kit, adipogenesis kit, monoclonal anti cd 90to fitc antibody produced in mouse for 100 tests, monoclonal anti cd 44 fitc antibody produced in mouse for100 tests, monoclonal anti cd 34 fitc antibody producedin mouse for 100 tests, monoclonal anti cd 45 fitcantibody produced in mouse for 100 tests, monoclonal anticd 11b fitc antibody produced in mouse for 100 tests, monoclonal anti cd 29 fitc antibody produced in mouse for100 tests, monoclonal anti cd 73 antibody produced inmouse bott of 100ug, monoclonal anti cd 105 fitcantibody produced in mouse for 100 tests, anti cd 166alcam antibody clone tag 1a3200 ul, monoclonal anti cd33 fitc antibody produced in mouse for 100 tests, bmpprotein human recombinant bott of ug, dulbeccos modifiedeagles medium low glucose bott of 500ml, plt maxhuman platelet lysate100ml //bid details2 / 29

Central Government/Public Sector

TRN :35597255 | 21 Oct, 2025

Tender Value : 19.15 Lacs

Hisar - Haryana

Tender for gem bids for h 360 diluent 20 ltr erba , h 360 lyse 500 ml erba , h 360 clean 50 ml erba , h 360 printer paper roll erba , thermal printer paper 56 x 33 mm , erba h 3 control normal , erba h 3 control high , erba h 3 control low , erba h cal , wash clean bott 50 ml ebra , kit for estimation of serum creatinine , kit for estimation serum urea , ra factor kit 1 x 50 ml , glucostrip one touch select plus bott of 50 test , disposable esr tube pck of 100 , methyl alcohal bott 500 ml , alpha count 60 diluent 20 ltr machine model medsure alpha count 60 , alpha count 60 lyse 500 ml bott machine model medsure alpha count 60 , alpha count 60 cleaner 1 ltr machine model medsure , alpha count 60 printer paper roll medsure alpha count , n 10 hcl bott 500ml , crp kit , glucometer one touch select plus simple , hcv rapid card pack of 25 test , hiv i and ii rapid card pack of 25 test , kit for estimation of alkaline phosphate erba , kit for estimation of bilirubin erba , kit for estimation of cholestrol erba , kit for estimation of glucose erba , kit for estimation of hdl , kit for estimation of uric acid erba , kit for estimaton of triglyceride erba , sgpt kit100ml ebra , sgot kit 100ml ebra , test tube round plastic disposal 5 ml , digital haemogloinometer complete , strips for digital haemoglobinometer pck 50 , disposal micropipette adjustable 0 50 ul , disposal micropipette adjustable 100 1000 ul , disposal micropipette fixed 1000 ul , kit for estimation of serum calcium , kit for estimation of total protein , hbalc kit clover a1c

Central Government/Public Sector

TRN :35598878 | 20 Oct, 2025

Tender Value : 0

Sonitpur - Assam

Tender for gem bids for reagents, blood typing dea i kit, kit sgot for erba chem 5x, kitsgpt for erba chem 5x, kit albumin for erba chem 5x, kittotal protein erba chem 5x, kit glucose for erba chem 5x, kit alp for erba chem 5x, kit creatinine for erba chem 5x, kit bun for erba chem 5x

Central Government/Public Sector

TRN :35599292 | 31 Oct, 2025

Tender Value : 6.22 Lacs

New Delhi - Delhi

Tender for gem bids for financial, sodium azide mb grade, silver nitrate 0 1 n solution, sodium chloride, sodium molybdate dihydrate, sodiumnitrite mb grade, sodium sulphate anhydrous, 3 m sodiumacetate ph 5 2 mb grade, sodium dihydrogen phosphatedihydrate, sodium hydroxide, sodium carbonateanhydrous acs 99 9 minimum purity, sodiumdiethyldithiocarbamate trihydrate acs minimum purity 99, sucrose pure, sulfuric acid pure hi ar, sulphanilamide hiar, 5 sulphosalicylic acid 3, sulfosalicylic acid dihydrateextra pure, 2 3 5 triphenyl tetrazolium chloride, 2thiobarbituricacidtba extrapurear 99, 40x tae buffer higrade, 10x tbe buffer, 5x t4 dna ligase buffer, tembotrione metabolite, tetracyclin, thiourea extra purear, titanium dioxide, titanium chloride, toluene lr grade, tris buffer, tris hcl buffer, trizol reagent 200 ml, trisbase mb grade 1 kg, tris hcl ph 8 0 1m 1000ml, triethanolaminepure 98, trichloroacetic acid tca, triton x100, uridine diphosphoglucose, 2 vinylpyridine, whatmanfilter paper no 1, yeast invertase, yeats hexokinase, yeastp glucose isomerase, zinc sulphate, zinc sulfateheptahydrate, dna isolation kit from plant, first strandcdna synthesis kit verso, genejet gel extraction kit, gsure rna isolation kit from pigeon pea, g9 taq dnapolymerase 10x buffer with mgcl2 5u l, pcr master mix 2x, one step rt pcr kit, hi efficiency ta cloning kit, purelink rna mini kit, rapid dna ligation kit, surespinplasmid mini kit, super dh5alpha comp cell, taq dna pol3u l including 10x buffer 25mm mgcl2, g9 taq dnapolymerase 10x buffer with mgcl2 5u ul, t4 dna ligase, trackit 100 bp dna ladder

Central Government/Public Sector

TRN :35583399 | 30 Oct, 2025

Tender Value : 72.2 Thousand

Kutch - Gujarat

Tender for gem bids for first aid bag for yodha rakshak kit, nasopharyngeal airway s-7, pill pack container, erba glucose kit test of 1 ml, erba cholestrol kit test of 1 ml, sysmax cell pack 20 ltr, sysmax cell cleaner bott of 50 ml

1
2
3

Related Searched Keywords : glucose kit

Get glucose kit Tender Alert...

Related Searched Keywords : glucose kit

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us

Copyright ©2018 - Thetenders.com.