Filters

List of protein Tenders

List of latest protein Tenders in Indian Tenders. Click on any protein Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for protein Tenders.

All-Tenders (71)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government And Public Sector

TRN :35623067 | 25 Oct, 2025

Tender Value : 0

Kota - Rajasthan

Tender for gem bids for glucose system pack reagent for bio-chemistry analyzer mindray bs -480 total cholestrol system pack reagent for bio-chemistry analyzer mindray bs-480 hdl cholestrol system pack reagent for bio-chemisrty analyzer mindray bs-480 ldl cholestrol system pack reagent for bio-chemisrty analyzer mindray bs-480 trigliceride system pack reagent for bio-chemisrty analyzer mindray bs-480 blood-urea system pack reagent for bio-chemisrty analyzer mindray bs-480 uric-acid system pack reagent for bio-chemisrty analyzer mindray bs-480 bilirubin-total system pack reagent for bio-chemisrty analyzer mindray bs-480 bilirubin-direct system pack reagent for bio-chemisrty analyzer mindray bs-480 sgot system pack reagent for bio-chemisrty analyzer mindray bs-480 sgpt system pack reagent for bio-chemisrty analyzer mindray bs-480 alkaline phosphatase system pack reagent for bio-chemisrty analyzer mindray bs-480 serum creatinine system pack reagent for bio-chemisrty analyzer mindray bs-480 cpk-nac system pack reagent for bio-chemisrty analyzer mindray bs-480 cpk-mb system pack reagent for bio-chemisrty analyzer mindray bs-480 ldh system pack reagent for bio-chemisrty analyzer mindray bs-480 calcium system pack reagent for bio-chemisrty analyzer mindray bs-480 total protein ystem pack reagent for bio-chemisrty analyzer mindray bs-480 phosphorus system pack reagent for bio-chemisrty analyzer mindray bs-480 amylase system pack reagent for bio-chemisrty analyzer mindray bs-480 albumin system pack reagent for bio-chemisrty analyzer mindray bs-480

Central Government/Public Sector

TRN :35624906 | 27 Oct, 2025

Tender Value : 0

Dimapur - Nagaland

Tender for gem bids for kit of estimation of albumin 50ml bott 1box aspen company , antistreptolysin o test latex agglutination principle, complete with control serum aso , kits for estimation of alkaline phosphatase 5 x 20 ml erba , kit for estimation of bilirubin 2 x 60 ml erba , kits for estimation of creatinine 2 x 60 ml erba , kits for estimation cholesterol 5 x30 ml erba , liq glycerine , kits for estimation of glucose 200ml bott 1box aspen company , hiv i and ii rapid test kit of 10 test , hcv rapid card kit , kit for estimation of hdl cholesterol kit of 50 tests , leishman stain ready to use 1 x 500ml , paracheck test for malaria pv and pf , microtips in closed box of 96 tips 5ul to 200 ul, pack of 960 tips , microtips in closed box of 96 tips 100 ul to 1000 ul pack of 960 tips , pregnancy test card , kits for estimation of sgot ast 5 x 20 ml erba , kits for estimation of sgpt alt 5 x 20 ml erba , total protein test kit , kit for triglyceride estimation 1x50ml , kits for estimation of urea 5 x 20 ml erba , kits for estimation of uric acid 5 x 20 ml erba , keto diastix bott of 50 strips , blood group a b ab d reagent 10 ml each for a b o x 1box , dengue rapid test ns ag igm plus igs combo pack for 10 test , vaccum blood collection tubes with flash backe nedles edta 2ml 3ml , hydrochloric acid soln , ra factor rf latex kit 25 test , sterile urine container 50 ml pkt of 100 bott , vdrl test card kit of 10 test , wbc diluting fluid bott , disposal esr test tube , rapid card screening for hbv , rbc diluting fluide , red vial , kit for scrub typhus test , spirit 500ml , widal test kit 4x5 , disposable glucometer lancet for finger prick pkt of 100

Central Government/Public Sector

TRN :35624933 | 24 Oct, 2025

Tender Value : 0

Pauri Garhwal - Uttaranchal

Tender for gem bids for badam 01 kg, chana 01 kg, mungfali 01 kg, kismis 01 kg, kaju 01 kg, protein 02 kg

corporations/Associations/Others

TRN :35626048 | 04 Nov, 2025

Tender Value : 0

Mumbai - Maharashtra

Tender for gem bids for randox specific protein assayed control l2 3x1 ml, randoxc1 wash solution 2.5 ltrs

Central Government/Public Sector

TRN :35626378 | 25 Oct, 2025

Tender Value : 0

Jammu - Jammu And Kashmir

Tender for gem bids for echs, bid number gem2025b6735965 dated 15-10-2025 bid document1 58 0 0 urostomy bag with flange size 60 65mm, walking aidmonopod assist, aceclofenac 100mg plus paracetamol325mg plus chloroxazone 250 mg tab, aceclofenac 100mgplus paracetamol 325mg plus serratiodase 15mg tab, aceclofenac 200 mg sr tab, lotion aloevera plus vit e, amisulpride 50 mg tab orodispersible, amorolfine 5percentage nail lacquer, aspirin 75mg plus atorvastatin 10mg plus clopid 75mg tab, aspirin 75mg plus atorvastatin20mg plus clopid 75mg tab, atenolol 50 mg plusamlodipine 5 mg tab, gel azelaic acid 20 percentage 15gm, azelnidipine 16 mg tab, tab benidipine 8 mg, betamethasone valerate cream 0 point 1 percentage plusneomycin sulphate 0 point 5 percentage oint, betamethasone dipropionate 0 point 025 percentage w wneomycin 0 point 5 percentage w w clotrimazole 1percentage w w cream tube of 20 g, bethanecol chloride25 mg tab, tab bilastine 20mg, bimatoprost 0 point 03percentage bott of 3ml eye drop, biotin 10mg iron 8mg lcysterine 5mg manganese 5 mg copper selenium l lysine20mg zinc 25mg dimethionine 40mg calcium pantothenate50mg niacinamide 50mg follhair tab, tab brivaracetam100mg, tab brivaracetam 50mg, bromelain 180 mg plustrypsin 96 mg plus rutoside 200 mg tab, calcium citratemalate and vitamin d3 tab, carvedilol 10 mg tab, ceritinib 150 mg cap, chloramphenical plus polymaxin bsulphate plus dexa eye drop, tab chlorthalidone 6 point 25mg, diclofenac 50mg plus paracetamol 325 mg pluschlorzoxazone 500 mg cipzox tab, clarithromycin 1percentage gel 15 gm tube, cream clobetasol0 point 05percentage salicylic acid 3 point 0 percentage urea 10 point0 percentage lactic acid 3 point 0 percentage, clofazimine100mg cap, clomiphene citrate 100 mg tab, creatininetest kit 4x50ml, diamond burs taper sf 11, tab diclofenac50mg plus serratiopeptide 10mg, diclofenac spray bott of40 gm, dorzolamide 2 percentage plus timolol 0 point 5percentage bott of 5ml eye drop, e d travoprost 0 point004 percentage plus timolol 0 point 5 percentage bott of 2point 5ml, entacopne 200mg plus levodopa 150mg pluscarbidopa 37 point 5 mg tab, eperisone 50 mg tab, tabescitalopram 10mg plus clonazepam 0 point 5mg, eveningprimrose 500 mg cap, fluvoxamine 50 mg tab point, tabdiacerin 50 mg plus glucosamine 750 mg, guaiphenesin ip100mg plus dextramethorphan 10mg plus phenylepherine5mg plus chlorpheniramine 4mg each 5ml sugar free syp, gum paint 15 ml, halobetasol propionate 0 point 05percentage cream tube of 10 gm, ketoconazole cream 2percentage tube of 30 gm, methylphenidate 18 mg tab, methylphenidate 10 mg tab, pioglitazone hydrochloride 15mg tab, syp ambroxyl 20mg 5ml plus chlorpheniraminemaleate 2mg 5ml plus dextromethorphan hydrobromide10mg 5ml, venlafaxine 37 point 5 mg tab, fluconazole50mg tab, test of estimation of total protein erba semiautonalyser reagent 5x50 ml, test for estimation ofalbumin erba semi autoanalyser reagent 5x50, kit forestimation of calcium erba semi auto analyser reagent2x50ml, thermal printer paper roll size 57mm 20mtr, disposable plastic tubes 75x12 mm, kit for amylaseestimation, erba wash 2x50ml, nycocard reader iireagent hba1c test kit 24 test, nycocard reader ii hba1ccontrol reagent, micropipettes fixed volume 1000, micropipette fix vol 500 ul, micropipette fix vol 100ul, micropipette fix vol 50ul, micropipette fix vol 20ul,

Central Government/Public Sector

TRN :35608251 | 25 Oct, 2025

Tender Value : 28.94 Lacs

Agra - Uttar Pradesh

Tender for gem bids for mh, ibuprofen 200 mg tab, povidone iodine 10percent solutionbott of 100 ml, tinidazole 500 mg tab, paracetamol 325mg plus diclofenac sodium 50 mg tab, roxithromycin 150mg tab, albendazole 400 mg tab, ofloxacin 400 mg tab, losartan 25 mg tab, losartan 50 mg tab, diclofenac 25mgperml ip 3 ml inj, ibuprofen 400 mg tab, aceclofenac100 mg tab, levofloxacin ip 250 mg tab, ciprofloxacin500 mg plus tinidazole 600 mg tab, fluconazole 150 mgcappertab, inj cefoperazone 500 mgplus sulbactum 500mg vial, inj benzathine penicillin 12 00 000 i.u. vial, povidone iodine 5percent ointment 250 gm jar, ranitidine150 mg tab, vitamin b complex with a minimumconcentration of vit b1-5mg vit b6-3mg and vit b12-5mcgtherapeutic tabpercap, diclofenac gel 1percent tube of 30gm, amikacin sulphate 250 mgper2 ml inj, cefotaximesodium 1gm inj, ceftazidime 1 gm inj, ceftriaxone 1 gm inj, cefuroxime 250 mg tab, cefixime 100 mg tab, doxycycline cap 100mg, gentamycin sulphate inj imperiv40mgperml 2 ml inj, azithromycin 500 mg tab, meropenem 500 mg inj, inj amikacin sulphate 250mgperml, adhesive plaster zinc oxide 2.5cm x 1mtr, bandage triangular, compression elastic bandage for dvtsmall, compression elastic bandage for dvt medium, compression elastic bandage for dvt large, lint absorbentcotton, adjustable arm pouch sling large medium andsmall, foleys balloon catheter 2 way silicon 16g, foley surinary catheter siliconeperantibacterial coated 3 way size-14, foley s urinary catheter siliconeperantibacterialcoated 3 way size -16, foley s urinary cathetersiliconeperantibacterial coated 3 way size -18, glucostripsone touch select bott 50 tripsferopenem 200mg tab, flupentiol 0.5mg + melitrxcen 10mgtab, flupirtine 100 mg er tab, fungal diastase 50 mg tab, /bid number: gem/2025/b/6741185* /dated: 11-10-2025 & & / bid document1 / 59 ginko biloba 120mg tab, gliclazide 80 mg tab, glimepride2mg + metformine 500 mg tab, glimepride 1mg +metformine 500 mg tab, glimepride 2mg + metformine sr1gm tab, glucosamine 500mg + diacerin 50mg tab, glycopyrolate 2 mg tab, iguratimod 25 mg tab, imipramine25 mg tab, lacosamide 100 mg tab, lacosamide 200 mgtab, lacosamide 50 mg tab, levetiracetam 250 mg tab, linagliptin 2.5 mg +metformin 1000 mg tab, linagliptin 2.5mg +metformin 500 mg tab, loratidine 10 mg tab, mebeverine 200 mg tab, megesterol acetate 80 mg tab, melalatonin 3 mg tab, mesalamine 1.2 gm tab, methylcobalamin 500 mcg tab, methylprednisolone 8 mgtab, mifenamic acid 250mg + tranexamic acid 500mg tab, moxonidine 0.2 mg tab, moxonidine 0.3 mg tab, nifedipine10 mg sr tab, nifedipine r 20 mg tab, nitroglycerine 6.4 mgtab, olmisartan 40mg + hydrochlorthiazide 12.5 mg tab, posaconazole 100 mg tab, rifaximine 400 mg tab, rosuvastatin 10 mg tab, rosuvastatin 40 mg tab, safinamide 50mg tab, selegilne 05 mg tab, serratiopeptidase 10 mg tab, simvastatin 10 mg tab, sitagliptin phosphate 50 mg tab, sofosbuvir 400 mg +velpatasavir 100 mg tab, tenilgliptin 20 mg tab, tenilgliptin20 mg+metformin 500 mg tab, tenofovir 300 mg +ajenamide 25 mg tab, thiocolchicoside 4 mg tab, tizanidine2 mg tab, tolperisone hcl 150 mg tab, topentadol 50 mgtab, torsemide 10 mg+spironolactone 25 mg tab, torsemide 20 mg tab, trifluoperazine 05 mg tab, trifluoperazine 05 mg +trihexiphenidyl 02 mg tab, ubiquinol 100 mg tab, vilazodone 20mg tab, tacrolimus0.1% w/w tacvido forte oint 20gm, trypsin 96mg+bromelain 180mg + rutoside trihydrate 200mg tab, ungacyclovir skin 5 % w/w tube of 5 gm, collagen peptide 40mg + sodium hyaluronate 30 mg tab, glucostrips foraccucheck active bott of 50 strips, hydrochlorothiazide 12.5mg tab, eye gel hydroxypropyle methyl cellulose 0.3% w/wbott of 10ml, megestrol acetate 160 mg tab, vit b121500mcg + alpha 100mg + myo 100mg + fa 1.5mg +selen 55mcg cap, naproxen 500 mg tab, nebivolol 2.5 mgtab, neomercazole carbimazole 10mg tab, neomycin+beclometahsone +clotrimazole e/d 5 ml, nepafenac0.3%w/v 5 ml ed, nitroglycerin 2.6mg tab, ointbeclomethasone + salicylic acid 20 gm tube, olanzapine 2.5mg tab, pancreatin 10000 iu tab, piracetam 400 mg tab, pregabalin 75 mg + nortriptyline 25 mg tab, rosuvastin 10mg + aspirin 75 mg +clopidogril 75 mg tab, rotacapfluticasone 100mcg + salmetrol 50mcg / dose, saxagliptin2.5 mg tab, serrratiopeptidase 5 mg tab, sertraline 25 mgtab, silodosin 4 mg + dutasteroide 0.5 mg tab, silodosin 8mg + dutasteroide 0.5 mg tab, silymarin 70 mg tab, sodium valproate 300 mg cr tab, sodium valproate500mg tab, spironocatone 25 mg +frusemide 20 mg tab, spironolactone 50 mg tab, syrup iron + folic acid bott of200 ml, sgpt kit of 5 x 20 ml, sgot kit of 5 x 20 ml, glucose test kit 2 x 200 ml, blood urea reagent 1 2x60ml& reagent 2 60ml, bilirubin total + direct reagent 1 2x60micro ltr and reagent 2 2x60 micro ltr, uric acid kit of 5x20micro ltr, serum creatinine, reagent 1 2x60ml reagent 22x60ml, triglycerids kit of 5x20 micro ltr, cholesterol kitof 5 x 20 ml, urine sugar strips, each bottle of 100 strips, typhidot box of 50 test, total protein kit of 5x50ml, alkalinephosphate kit of 10x2.2 micro ltr, calcium kit of 5 x 20micro ltr, albumin kit of 5 x 50 ml, widal kit of 5ml x 4, rafactor kit of 50 test, adhesive plaster, zinc oxide, 2.5cm x1mtr, trioxsalen 25 mg tab, valacyclovir hydrochloride 500 //bid details2 / 59

Central Government/Public Sector

TRN :35608380 | 25 Oct, 2025

Tender Value : 0

Srinagar - Jammu And Kashmir

Tender for gem bids for enalapril 5 mg tab entacavir 0point5 mg tab enteral feedpowdercomma protein 85percentcomma eplerenone 25mg tab tab escitalopram 10 mg estriol 1 mg vaginalcream evalon etoricoxib 120 mgcomma tab edtobramycin 0point3percent bott of 5 ml ed gentamicinsulphate 0point3percent wv gentamicin ciprofloxacin hcl0point3percent tube of 5 gmpoint fenofibrate 200 mg tab fentanyl 25 mcg transdermal fexofenadinehydrochloride 120 mg tab tab fexofenadine 180 mg tabfinasteride 5mgpoint tab flavoxate 200 mg fluconazolecaptab 150mg tab flunarizine 10 mg cap fluoxetine 20mg fluvoxamine 50 mg cap formoterol 6 mcg plusglycopyrronium 25 mcg dry rotacap tiotropium bromide18 mcg plus formeterol framycetin sulphate cream bp1percent 100 gms tab frusemide 20mg plusspironolactone 50 mg frusemide 40 mg tab gammabenzene hexachloride 1percent wv cntrimide edgatifloxacin 0point3percent eye drop bott of 5 ml gauzesurgicalcomma open wovecomma unmedicated tabglipizide 5 mg glucosamine 250 mg plus chondrotinsulphate 200 mg cap glucosamine 500 mg tab tabnitroglycerine 2point6 mg gum paint bott of 15 ml 0point05 per halobetasol propionate plus 3 percent salic haloperidol 5 mg tab haloperidol syp 2mgml bott of 30 ml tab hydrocortisone 5 mg hydrogen peroxide solutionwith stabilizer ip 20 vol hydroxyurea 500 mg cap tabibandronate 150 mg ibuprofen syrup 100mg5ml bott of 50ml ibuprofen 200 mg tab imipramine 25 mg tab indomethacin 25mg tabcap inh budesonide 200mcg formoterol 6 mcg plus tiotropium 9mcg mdi inahler salmeterol 25 mcg plus fluticasone 125 mg mdi co pheniramine maleate inj 22point75 mg per ml amp of 2ml adrenaline tartrate 11000comma 1 ml inj inj denosumab bid number gem2025b6752532 dated 11-10-2025 bid document1 108 0 0 60mgml, dexamethasone sodium phosphate 4point4 mg e, inj drotaverin hcl 1percent 20mgml amp of 2ml, frusemide 20 mg comma2 ml inj, injpointhydrocortisonesodium succinate 100mg, hydroxyprogesterone caproate500 mg2 ml amp of 2 ml inj, levofloxacin 500 mg inj, lignocaine hcl 2percent with adrenaline 180000, injmethoxy polyethylene glycolepoetin beta 50, injmultivitamin iv 210 ml with minimum constituents, injmethoxy polyethylene glycolepoetin beta 100 mc, nandrolone decanoate 25mgml inj, paracetamol150mgmlcomma 2 ml inj, paracetamol 10 mgml infusion in100 ml bott, pneumococcal conjugated polysaccharidevaccine 0poin, tramadol hcl 50mgml injpoint, injtranexamic acid 500 mg5ml, tetanus toxoidcommapurified absorbed rubber capped, inj zolendronic acid 5 mg, inj insulin highly purified isophanehuman nph40iumlcomm, insulin premixed biphasic 40 iu per ml30percent human ne, disposable insulin syringe 1ml, ipratropium bromide respirator soln 500 mcg2ml resp of 2ml, isapgol ispaghula husk 3point5 gm, isosorbidemononitrate 20 mg tab, tab isosorbide dinitrate 10 mg, ivermectin tab 6 mg perpntab, ketorolac 10 mg tab, tablcarnitine 500 mg, leflunomide 20 mg tab, tab letrozole2point5 mg, tab levetiracetam 1000mg, leveteracetam500mg tab, levofloxacin 250 mg tab, tab levosulpride 25mg, lithium carbonate 300 mg captab, lorazepam 1 mgtab, lorazepam 2mgmlcomma 2 ml injpoint, losartan 50mg tab, lotepredenol etabonate 0point5percent bott of 5ml, mebeverine hcl 135mg tab, tab metformin 500 mgplus vildagliptin 50 mg, methotrexate 5 mg tab, methylprednisolone 16 mgcomma tab, tabmethylprednisolone 4 mg, tab metoclopramide 10 mg, metronidazole 1 percent tube of 30gm, minoxidil 5 percentlotion bott of 60 ml, tab naproxen 250 mg, nebivolol 5mgtab, tab nicorandril 10mg, nicorandil 5 mg tab, olanzapine 10 mg tabpoint, tab olanzapine 5 mgpoint, tab olapatadine 5 mg, ondansetron 8 mg tab, ondansetron syp 2 mg5ml in bott of 30 mlpoint, pancreaticenzyme supplement with a lipase content o, tabparacetamol 500 mg plus ibuprofen 400 mg, paroxetine 25mg tab, paroxetine xr 12point5 mg tab, tab pazopanib400 mg, perindopril 4mg tab, cream permethrine 5percent tube of 30gmpoint, pheniramine maleate of 25 mgtab, pioglitazone hydrochloride 15 mg tabpoint, tabpiroxicam 20 mg, povidone iodine solution 5percent bott of100 ml, pregabalin 75mg methylcobalamine 1500mcg tab, propranolol tr 40 mg tab, tab quetiapine 100mg, tabquetiapine 50 mg, ranitidine 150 mg tab, erythropoietinrecombinant human 4000 iupoint, tab rifaximin 400mg, cap rifaximin 550 mg, risperidone 1 mgml syp in bott of30 ml, tab risperidone 2 mg tab, tab risperidone 4 mg, tab rivaroxaan 10mg, rizatriptan 5 mg tab, tab sacubitril24 mg plus valsartan 26 mg, tab sacubutril 49mg plusvalsartan 51mg, salmeterol 50 mcg plus fluticasone 500mcgcomma a, tab saroglitazar 4 mg, tab saxagliptin 5mg, tab sertraline 100 mg, sertraline 50mg tabpoint, tabsevelamer 800 mg, sevelamer 400 mg tab, sildenafilcitrate 50 mg tab, silodosin 8 mg tab, tab simvastatin20mg, sitagliptin 50 mgplusmetformin 1000 mg tab, sodium chloride 0point65percent wv nasal drops of 15 ml, sodium valproate 200 mg tab, tab solifenacin 5mg, sterile water for amp of 10 mlpoint, sucralfate suspension1gm5ml bott of 200 ml, sulphamethoxazole 400 mgtrimethoprim 80 mg tabenalapril 5 mg tab, entacavir 0point5 mg tab, enteral feed

State Government

TRN :35610174 | 29 Oct, 2025

Tender Value : 10.00 Crore

Chandigarh Ut - Chandigarh

Tender for gem bids for reagent kit sodium for 05 years, reagent kit potassium for05 years, reagent kit chloride for 05 years, reagent kitglucose for 05 years, reagent kit urea for 05 years, reagent kit creatinine for 05 years, reagent kit uric acidfor 05 years, reagent kit calcium for 05 years, reagent kitphosphorus for 05 years, reagent kit magnesium for 05years, reagent kit total bilirubin for 05 years, reagent kitconjugated bilirubin for 05 years, reagent kit alkalinephosphatase for 05 years, reagent kit sgot for 05 years, reagent kit sgpt for 05 years, reagent kit total protein for05 years, reagent kit albumin for 05 years, reagent kitggt for 05 years, reagent kit amylase for 05 years, reagent kit lipase for 05 years, reagent kit total ck for 05years, reagent kit cpkmb for 05 years, reagent kit crp for05 years, reagent kit hscrp for 05 years, reagent kit rafactor for 05 years, reagent kit cholesterol for 05 years, reagent kit tg for 05 years, reagent kit hdl for 05 years, reagent kit ldl for 05 years, reagent kit apoa for 05 years, reagent kit apob for 05 years, reagent kit ada for 05years, reagent kit ldh for 05 years, reagent kit iron for05 years, reagent kit d dimer for 05 years, reagent kithba1c for 05 years, reagent kit cystatin c for 05 years, reagent kit ammonia for 05 years, reagent kit urinarytotal protein for 05 years, reagent kit csf total protein for05 years, reagent kit urinary albumin for 05 years, reagent kit urinary microalbumin for 05 years, reagent kitinsulin for 05 years, reagent kit ft3 for 05 years, reagentkit ft4 for 05 years, reagent kit tsh for 05 years, reagentkit vitamin d for 05 years, reagent kit vitamin b12 for 05years, reagent kit psa for 05 years, reagent kit afp for 05years, reagent kit ca 125 for 05 years, reagent kit ceafor 05 years, reagent kit cortisol for 05 years, reagent kitferritin for 05 years, reagent kit ipth for 05 years, reagent kit pct for 05 years, reagent kit total hcg for 05years

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Central Government/Public Sector

TRN :35612291 | 04 Nov, 2025

Tender Value : 0

Dharwad - Karnataka

Tender for gem bids for fast protein liquid chromatography, gel or blot imagingsystem i, gel or blot imaging ii, chiller for sonicator, animal blood pressure system

Related Searched Keywords : protein

List of protein Tenders

Tender for gem bids for badam 01 kg, chana 01 kg, mungfali 01 kg, kismis 01 kg, kaju 01 kg, protein 02 kg

Tender for gem bids for randox specific protein assayed control l2 3x1 ml, randoxc1 wash solution 2.5 ltrs

Tender for gem bids for fast protein liquid chromatography, gel or blot imagingsystem i, gel or blot imaging ii, chiller for sonicator, animal blood pressure system

Get protein Tender Alert...

Related Searched Keywords : protein

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us