Filters

List of air-conditioners Tenders

List of latest air-conditioners Tenders in Indian Tenders. Click on any air-conditioners Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for air-conditioners Tenders.

All-Tenders (209)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government / Public Sector

TRN :35623370 | 29 Oct, 2025

Tender Value : 1.86 Crore

Vadodara - Gujarat

Tender for gem bids for custom bid for services - 9030c25d01 annual rate contractfor online sealing job of steam hydrocarbon acid otherleaks for upcoming new units facilities under lupechprojects at gujarat refinery /

Central Government/Public Sector

TRN :35623996 | 10 Nov, 2025

Tender Value : 0

Ranaghat - West Bengal

Tender for procurement of glass unit of fixed window for medha under slung ac emu rakes etc..

Central Government / Public Sector

TRN :35624047 | 10 Nov, 2025

Tender Value : 0

Nanded - Maharashtra

Tender for supply of sulphuric acid 98% ar, un no.: 1830/8, cas no.: 7664-93-9, p/n : 00290- 42500, each unit is pack of 2.5 liters.

Central Government / Public Sector

TRN :35624643 | 17 Nov, 2025

Tender Value : 0

Khurda - Orissa

Tender for supply of roof mounted ac package unit rmpu..

Central Government / Public Sector

TRN :35626218 | 04 Nov, 2025

Tender Value : 12.35 Lacs

Ahmedabad - Gujarat

Tender for gem bids for comp, cm of 1.5tr non inverter split ac units, cm of 2 tr noninverter split ac units, cm of 2 x 1.5tr hsac units, replace pcb indoor unit inverter split ac units, replacepcb outdoor unit inverter split ac units

State Government

TRN :35608039 | 29 Oct, 2025

Tender Value : 8.00 Crore

Kanpur - Uttar Pradesh

Tender for gem bids for layer 2 access switch v2 q2, wireless access point v2q2, networking / server rack q2, small form - factorpluggable transceiver q2, cat6 4pair utp cable 305mtr inone box, cat6 4pair utp outdoor cable 305mtr in one box, information outlet cat 6, face plate with gang box, 1meter utp cat 6 patch cord, 3 meter utp cat 6patch cord, 24 port cat6 patch panel fully loaded, single mode fiber24 core armored unitube, 12 port fibre optic liu fullyloaded, 24 port fibre optic liu fully loaded, fibre patchcord sc-lc sm, duplex 2 meter, online ups 1 kva withminumum 15 minutes backup, hdpe pipe 40mm, 105x50mm dlp raceway with accessories, 80x50mm dlpraceway with accessories, 32 mm pvc heavy conduit withaccessories isi mark, 40 mm pvc heavy casing withaccessories isi mark, flexible pipe 25 40 mm, laying ofutp cable in raceway conduit casing hdpe, installationand termination of i o user side including i opunching, labelling and testing, installation of jack panelincluding i o punching, labelling and testing, installation offace plate and gang box including i o punching, labellingand testing, trenching for outdoor utp cables as perinstructions including digging, laying of hdpe pipes as perlaying instructions for outdoor utp cables including 32 40mm hdpe pipe, laying of fibre cable in hdpe pipes as perlaying instructions including hdr drilling, hdpe pipe, fibrepulling, route markers, pits etc., digging the concrete androad cutting, supply and installation 2 inch gi pole for theoutdoor access point, installation of rack 32 15 9u, installation of liu including 26 splicing, installation ofswitch, installation of access point, onsite networkengineer for 5 year support, construction of huts as perdesign provided

Central Government/Public Sector

TRN :35609135 | 04 Nov, 2025

Tender Value : 0

Nicobar Island - Andaman And Nicobar Islands

Tender for gem bids for 25pvhc001, bid number gem2025b6654709 dated 13-10-2025 bid document1 40 1 1 ev3108b 14404479 suction filter, ev3108b-14201355o ring ref ih 50, ev3108b-12007360 pump stop valve, ev3108b 30120015 dc v seal kit for propostional, ev3108b-30120009 boost filter element, ev3108b30120028 pump p6p pump with valve assly, ev3108b-30120041 relief valves, ev3108b-30120001 hydrauliccylinder seal kit, ev3108b-30120014 dc v seal kitfor locking valve, ev3108b 41065037 i p carrier-123, ev3108b-6221904 bimetal olr 0 5-0 8a, ev3108b-623-00016 shaft seal, ev3108b 6403072 lub motorcontactor coil 110vac 30 ampsohz, ev3108b -ac3 -50hz contactor ac3 sohz 110 amps 380 440v 3no 3nc, ev3108b -s-2303642 feedback potentiom eter assy, ev3108b -vhdp25009 boost filter element, ev3108b-033 -71526 port plate p6p clock wise, ev3108b 033-71619 side plate, ev3108b -1194g-30120001 actuatorseal kit, ev3108b -211 -43334 reple nishing gerotorassyclosed loop only, ev3108b-230-82146 needlebearing, ev3108b -230-82148 shaft bearing, ev3108b-230 -82164 thrust bearing, ev3108b -23000467 metertaut band centre zero 1 0 1ma, ev3108b -1194g -30120013 bearing de n d e, ev3108b-1194g 30120096thrust washer, ev3108b -1194g-30120097 oil seals, ev3108b 13005409 gasket, ev3108b-033-57328 swashangle potentiometer, ev3108b-033-71921 barrelface plate, ev3108b -033 -91076 housing gasket, ev3108b-033-91190 bearing, ev3108b-063g062hydraulic actuator, ev3108b-14402797 directionalvalve 4 way, ev3108b-14402869 p11p pump seal kit, ev3108b-14404482 vibration mount, ev3108b-14404792 relief valve, ev3108b-17040053 solid staterelays ssr, ev3108b-30120030 seal kit for manifoldblock, ev3108b- 30120093 seal kit, ev3108b-30120311 swash feed back potentiometer, ev3108b-30140010 2a hrc fuse base link, ev3108b -30140068fuses, ev3108b 31096031 lambda regulated poersupply unit 24v, ev3108b-41065034 power supplymodule, ev3108b-41065036 vme cpu, ev3108b41065038 tip 465 rs 422 programmable serialinterface, ev3108b 41065041 i o modules d1, ev3108b-4106s041-42 i o modules digital inputoutput, ev3108b-41065044 analog output module, ev3108b-41065051 sav 12 servo amplifier unit, ev3108b -671 -00129 o ring, ev3108b-671-00144 o ring, ev3108b 671-00147 o ring, ev3108b-671-00249 seal retainer o-ring, ev3108b-691-001250 ring, ev3108b-91044002lcd display unit - 4 line 20c, ev3108b s13-43334replenishing gerotor assyclosed loop only, ev3108b -s13-43963 centre port plate, ev3108b-vhdp25005 valve assembly servo //bid details2 / 40

Central Government/Public Sector

TRN :35609175 | 04 Nov, 2025

Tender Value : 0

Port Blair - Andaman And Nicobar Islands

Tender for gem bids for er6170b-2khn150a diode 150a 200v 150amps , er6170b-2a-3065 transistor block keltron compton reeves eqv , er6170b-35b1400-oa 35a 10 lbo push switch , er6170b-52hr6 diode 6a 200v , er6170b-6210- 99-521-8855 35 degree secured flood light 24v 150w c w lamp , er6170b-c10p-336b local remote switch , er6170b-ch- iccp- cor choke red local , er6170b-gc nlp glass cartridfe fuse , er6170b-iccp-controlunit-corvet iccp control unit for corvettes , er6170b-fh-1-7 fuse holder , er6170b-led indicating lamp , er6170b-khn hr sm diode 100a 200 piv or higher , er6170b- l-il-lamp for 415b , er6170b-re-spp cor single phase preventor module , er6170b-s-96 voltmeter voltmeter ac 300 volts , er6170b-tia32 hrc fuse ling 32amps , er6170b-4s26d selector switch for ammeter 10a 6a 2pole away , er6170b-led amber indicating lamp amber , er6170b-mcc over load relay 24v 5 amps , er6170b-nsh fuse base for links , er6170b-r-type relay 24v , er6170b-rt-481b light on off switch recom kaycee , er6170b-s-72 50a ammeter 0 50a ae eqv , er6170b-srpm1390 voltage selector switch 16a 3 pole 4 way , er6170bvsk-315 fuse link 315a

Central Government And Public Sector

TRN :35610201 | 01 Nov, 2025

Tender Value : 10.93 Lacs

Khandwa - Madhya Pradesh

Tender for gem bids for gas 410a, gas r32, gas r22, anti clock wise blowermotor for 2 ton blue star split ac, clock wise blower motorfor 2 ton blue stars split ac, clock wise blower motor for 2ton voltas split ac, pcb for indoor unit 2 ton blue star acmodel no bi 3hw 24jbx, pcb for indoor unit 1.5 ton bluestar ac or universal ac, universal pcb for indoor unit 2 tonac, contactor for 2 ton blue star split ac outdoor unit 8amp, drain pipe for indoor unit voltas ac or blue star ac, 4 wire swing motor for blue star ac indoor unit 12 volt dc, compressor lugs, brazing rod, coil sensor for 2 ton splitac, coil sensor for 3 ton tower ac, coil sensor for 2 tontower ac, air sensor for 2 ton tower ac, air sensor for 2ton split ac, rotary compressor for 2 ton split ac, rotarycompressor for 1.5 ton split ac, disposable lpg gas cane200gm, brazing powder half kg pack, insulation tape blackcolour 2 inch, mpd for 17 tr voltas make package ac modelno.acdpwwsc 170dnp, mpd for 11 tr voltas makepackage ac model no.acdpwwsc 110dnp, belt for voltasmake package ac part no.a850 or a32, fan for diakin maketower ac 4 ton capacity dia 12 inch depth 7 inch, pcb forindoor unit diakin make tower ac 4 ton capacity partno.08dfco500ro 0051, pcb for outdoor unit diakin maketower ac 4 ton capacity part no.r50044131606, anti clockwise blower motor for 4 ton daikin tower ac partno.m5fs50ar501, hermatically sealed compressor 4 toncapacity diakin make, cable tie 150mm length in packet, cable tie 250 mm length in packet, cable tie 400 mmlength in packet

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Related Sub Industries : Air Conditioners

List of air-conditioners Tenders

Tender for gem bids for custom bid for services - 9030c25d01 annual rate contractfor online sealing job of steam hydrocarbon acid otherleaks for upcoming new units facilities under lupechprojects at gujarat refinery /

Tender for procurement of glass unit of fixed window for medha under slung ac emu rakes etc..

Tender for supply of sulphuric acid 98% ar, un no.: 1830/8, cas no.: 7664-93-9, p/n : 00290- 42500, each unit is pack of 2.5 liters.

Tender for supply of roof mounted ac package unit rmpu..

Tender for gem bids for comp, cm of 1.5tr non inverter split ac units, cm of 2 tr noninverter split ac units, cm of 2 x 1.5tr hsac units, replace pcb indoor unit inverter split ac units, replacepcb outdoor unit inverter split ac units

Get Air Conditioners Tender Alert...

Related Sub Industries : Air Conditioners

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us