Filters

List of salt Tenders

List of latest salt Tenders in Indian Tenders. Click on any salt Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for salt Tenders.

All-Tenders (1)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

State Government

TRN :35627692 | 07 Nov, 2025

Tender Value : 0

Kolkata - West Bengal

Tender for vertical extension 2nd and 3rd floor of seminar room at the west bengal national university of juridical science at salt lake, kolkata - 700 106 civil and internal electrical works.

State Government

TRN :35627718 | 31 Oct, 2025

Tender Value : 1.64 Lacs

Bankura - West Bengal

Tender for installation of 5 five nos. solar street light at various place of chandra village under gogra g.p within saltora development block, polling station no. 215, chandra k.s.h high school from apas fund during the f.y 2025-26

Central Government/Public Sector

TRN :35608164 | 31 Oct, 2025

Tender Value : 2.69 Lacs

Hazaribagh - Jharkhand

Tender for gem bids for trichloroacetic acid emplura, tiba, 2 4 d, iaa, naa, 6bap, kinetin, chitosan, aba, ccc, jasmonic acid, ethephon, maleic hydrazide, melatonin, prohexadionecalcium, colchicine, alpha amylase, sodium phosphate, sodium thiosulphate, trolox, tptz, absolute ethanol, trisbuffer ar, edta dipotassium, tris hydrochloride, caffeicacid, caffeine, naringenin, chloroform, water nucleasefree, cetyltrimethyl ammonium bromide ctab, nitro bluetetrazolium chloride nitro bt nbt, sodiumdiethyldithiocarbamate trihydrate acs, sodiumthiosulphate pentahydrate, cellulase, protease, petroleumether, sulphosalicylic acid, glutathione oxidized, polyethylene glycol, naringin, limonin, murashige andskoog basal salt mixture ms

Central Government/Public Sector

TRN :35609981 | 03 Nov, 2025

Tender Value : 0

Jaisalmer - Rajasthan

Tender for gem bids for common salt for chemical industries (v2) conforming to is 797 (q3)

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Central Government/Public Sector

TRN :35611492 | 03 Nov, 2025

Tender Value : 0

Jaisalmer - Rajasthan

Tender for gem bids for magnesium sulphate (epsom salt) as per is 2730 (q3)

Central Government And Public Sector

TRN :35613454 | 06 Nov, 2025

Tender Value : 0

Bela - Bihar

Tender for supply of edible common salt to is:253/1985.

Central Government/Public Sector

TRN :35614020 | 04 Nov, 2025

Tender Value : 0

Ernakulam - Kerala

Tender for gem bids for ladle medium board paste wooden bucket ice spice box container cereal with lid 10kgs coning carafe 6 cups dish pie 20 cms dish pie 30 cms egg beater kettle tea electric 2 ltrs squeezer lime jar pickle glass with cover basket rations box salt can milk 5 ltrs counter balance spring 1-15 kgs machine mincing hand large mesher potato scoop flour hand mk ii strainer gravy round strainer rice 50 cms x 25.5 cms urn for tea/coffee ss 50 cups dish flat 25 cms dish preserve round bone china 16 cms jug cream bone china 250 ml bowl finger lable wine port lable wine sherry saucer tea earthenware bowl soup katori plate soup bone china plate tea bone china pot tea bone china 1 ltrs pot coffee bone china 1 ltrs saucer coffee bone china tumbler slicer fish

Central Government/Public Sector

TRN :35614743 | 01 Nov, 2025

Tender Value : 0

Imphal - Manipur

Tender for gem bids for cap autrin pizer , cap becosule z aboott , tab b compex zevit , cap doxycycline hydrocloride 100mg , cap evion 400 mg , cap itraconazole 200mg , cap pantop dsr , cap tripsyn and chymotripsyn chymoral forte , tab aceclofenac plus serratiopeptidase plus paracetamol , tab albendazole 400mg , tab amlodipine besylate 5mg , tab amoxycillin 500mg clavulanic acid 125mg gsk , tab antacid chewable abbott , tab aspirin 75mg usv , tab atorvastatin 10mg , tab azithromycine 500mg alembic , tab bisacodyl 10 mg , tab calcium carbonate 500mg plus vit d3 shalcal , tab cefixime 200mg , tab cetrizine dihydrochloride 10mg , tab clopidogrel 75mg , tab combiflam sanofi , tab common cold sinarest , tab cough lozenges , tab cipzox cipla , tab diclofenac sodium 50mg novartis , tab dicyclomine hcl 20mg paracetamol 325mg , tab domperidone 10mg , tab fexofenadine 180mg sanofi , tab fluconazole 150mg , tab folic acid 5mg , tab glimepride 1mg , tab glucosamine 500 mg , tab indapamide , tab levocetrizine 5mg , tab limcee 500 mg , tab losartan 50mg , tab liv 52 , tab metformin sr 500 mg , tab methylcobalamine 1500mcg , tab montelukast 10mg levocetrizine 10mg cipla , tab metronidazole 400 mg , tab naproxen 250mg , tab norfloxacin 400mg , tab ondansetron 4mg , tab pantoprazole 40mg cipla , tab paracetamol 500mg dolo , tab paracetamol 650mg dolo , tab pheniramine maleate avil 25mg , tab pregabalin 75mg , tab pregabalin 75mg plus methylcobalamine 1500mcg , cap preprobiotic , tab rantac 150 mg , tab telmisartan 40mg , tab thyroxine 50 mcg , vaginal pessary clotrimazole 100mg , syp azithromycine 200mg 5ml 60ml , syp albendazole 10ml , syp amoxycillin clavulanic acid bott of 30ml , syp amoxycilline bott of 30ml , syp antacid gel each 5ml containing dried aluminium hyroxide gel 170ml , syp benadryl bott of 160 ml johnson johnson , syp b vitamin b compex multivitamin b 12 bott of 200 ml , syp calcium with vitamin d3 160 ml bott , syp cetrizine 60ml , syp chlorpheniramine maleate pcm phenylephrine 60ml common cold , syp cough expectorant 5ml containing diphenhydramine bott of 100ml , syp iron for adults with vitamins 200ml , syp lactulose bottle of 100ml dufalac , syp ofloxacine 100mg 5ml metronidazole200mg 5ml 30ml , syp ondansetron 2mg 5ml in 30ml , syp combiflam bott of 60 ml , syp paracetamol 250 mg , syp salbutamol 2mg 5ml bottle of 100ml , syp sucralfate bott of 200ml , drop dicyclomine simethicone 10 ml , mouth wash chlorhexidine 100ml colgate , oint diclofenac nanoforte gel tube of 30 gm , oint anti haemorhoidal , oint clindamycin phosphate 1 topical gel tube of 10gm , oint luliconazole 1 30gm , oint miconazole nitrate tube of 15gm , oint mouth ulcer gel , oint mupirocin 2 5gm , oint povidone iodine 5 tube of 10gm , oint silver sulphadiazine 1 tube of 15gms , oint clotrimazole tube of 15 gm , cream urea bott of 20 gm , cream sunscrean lashield , lotion calamine 100ml , lotion dynapar qps bott of 50 ml , gargle povidone iodine bott of 100 ml , spray analgesic voliny spray , liq povidone iodine 5 100ml , e d tear plus cmc refresh tear , e d ciprofloxacin dexamethasone 5ml cipla , e d moxifloxacin 05 5ml cipla , mouth paint clotrimazole bott of 5 ml , ear d waxsole bott of 15 ml , pdr clotrimazole 1 bott of 75mg , sachet calciferol 60000 iu cadila , sachet isabgol ispaghula husk 3 point 5gm , sachet oral rehydration salt ors 20 point 5g , inhalar seroflo 250 mcg , n d sodium chloride 0 point 65 15ml nasoclear , n d xylometazolidine 10ml adult , nd oxymetazoline hcl , disposable mask triple layer , dressing medicated adhesive 25cmx 6cm single strip pack band aid , bandage crepe15cm , hand sanitizer 100 ml bott , sanitary pad , steamer , nebuliser , bp apparatus digital , tennis elbow support size l andxl , tynor portable ortho heating pad , elbow support , ankle support , arm sling pouch , knee cap tynor size m and l , l s belt tynor size m and l , silicon heal pad tynor , walker , walking stick , wheel chair foldable , glucometer strips accucheck active bot of 50 , glucometer accucheck active , cervical collar tynor , powder protein 200gm , pdr glucose d pkt of 30 gm , lotion v wash bott of 100 ml , shampoo scalpe plus ketokonazole , tab sitagliptin 50 mg , tab tamsulosin 0 point 4 mg , syp liv 52 , tab meftal spas , tab zinc sulphate 20 mg , syp zinc 20 mg 5ml cap autrin pizer, cap becosule z, tab b compex zevit, cap doxycycline hydrocloride 100mg, cap evion 400 mg, cap itraconazole 200mg, cap pantop dsr, cap tripsyn and chymotripsyn chymoral forte, tab aceclofenac plus serratiopeptidase plus paracetamol, tab albendazole 400mg, tab amlodipine besylate 5mg, tab amoxycillin 500mg clavulanic acid 125mg gsk, tab antacid chewable abbott, tab aspirin 75mg usv, tab atorvastatin 10mg, tab azithromycine 500mg alembic, tab bisacodyl 10 mg, tab calcium carbonate 500mg plus vit d3 shalcal, tab cefixime 200mg, tab cetrizine dihydrochloride 10mg, tab clopidogrel 75mg, tab combiflam sanofi, tab common cold sinarest, tab cough lozenges, tab cipzox cipla, tab diclofenac sodium 50mg novartis, tab dicyclomine hcl 20mg paracetamol 325mg, tab domperidone 10mg, tab fexofenadine 180mg sanofi, tab fluconazole 150mg, tab folic acid 5mg, tab glimepride 1mg, tab glucosamine 500 mg, tab indapamide, tab levocetrizine 5mg, tab limcee 500 mg, tab losartan 50mg, tab liv 52, tab metformin sr 500 mg, tab methylcobalamine 1500mcg, tab montelukast

State Government

TRN :35615649 | 28 Oct, 2025

Tender Value : 1.86 Lacs

Kolkata - West Bengal

Tender for upkeeping in the premises of chief engineer south under irrigation and waterways department, jalasampad bhawan, 1st floor, salt lake, kolkata during the year 2025-26 wbiw/ee/cdod/e-nit- 11/2025-26 sl-1

Related Sub Industries : Food Grains

List of salt Tenders

Tender for vertical extension 2nd and 3rd floor of seminar room at the west bengal national university of juridical science at salt lake, kolkata - 700 106 civil and internal electrical works.

Tender for installation of 5 five nos. solar street light at various place of chandra village under gogra g.p within saltora development block, polling station no. 215, chandra k.s.h high school from apas fund during the f.y 2025-26

Tender for gem bids for common salt for chemical industries (v2) conforming to is 797 (q3)

Tender for gem bids for magnesium sulphate (epsom salt) as per is 2730 (q3)

Tender for supply of edible common salt to is:253/1985.

Tender for upkeeping in the premises of chief engineer south under irrigation and waterways department, jalasampad bhawan, 1st floor, salt lake, kolkata during the year 2025-26 wbiw/ee/cdod/e-nit- 11/2025-26 sl-1

Get Salt Tender Alert...

Related Sub Industries : Food Grains

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us