Filters

List of protein-powder Tenders

List of latest protein-powder Tenders in Indian Tenders. Click on any protein-powder Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for protein-powder Tenders.

All-Tenders (15)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Central Government/Public Sector

TRN :35614743 | 01 Nov, 2025

Tender Value : 0

Imphal - Manipur

Tender for gem bids for cap autrin pizer , cap becosule z aboott , tab b compex zevit , cap doxycycline hydrocloride 100mg , cap evion 400 mg , cap itraconazole 200mg , cap pantop dsr , cap tripsyn and chymotripsyn chymoral forte , tab aceclofenac plus serratiopeptidase plus paracetamol , tab albendazole 400mg , tab amlodipine besylate 5mg , tab amoxycillin 500mg clavulanic acid 125mg gsk , tab antacid chewable abbott , tab aspirin 75mg usv , tab atorvastatin 10mg , tab azithromycine 500mg alembic , tab bisacodyl 10 mg , tab calcium carbonate 500mg plus vit d3 shalcal , tab cefixime 200mg , tab cetrizine dihydrochloride 10mg , tab clopidogrel 75mg , tab combiflam sanofi , tab common cold sinarest , tab cough lozenges , tab cipzox cipla , tab diclofenac sodium 50mg novartis , tab dicyclomine hcl 20mg paracetamol 325mg , tab domperidone 10mg , tab fexofenadine 180mg sanofi , tab fluconazole 150mg , tab folic acid 5mg , tab glimepride 1mg , tab glucosamine 500 mg , tab indapamide , tab levocetrizine 5mg , tab limcee 500 mg , tab losartan 50mg , tab liv 52 , tab metformin sr 500 mg , tab methylcobalamine 1500mcg , tab montelukast 10mg levocetrizine 10mg cipla , tab metronidazole 400 mg , tab naproxen 250mg , tab norfloxacin 400mg , tab ondansetron 4mg , tab pantoprazole 40mg cipla , tab paracetamol 500mg dolo , tab paracetamol 650mg dolo , tab pheniramine maleate avil 25mg , tab pregabalin 75mg , tab pregabalin 75mg plus methylcobalamine 1500mcg , cap preprobiotic , tab rantac 150 mg , tab telmisartan 40mg , tab thyroxine 50 mcg , vaginal pessary clotrimazole 100mg , syp azithromycine 200mg 5ml 60ml , syp albendazole 10ml , syp amoxycillin clavulanic acid bott of 30ml , syp amoxycilline bott of 30ml , syp antacid gel each 5ml containing dried aluminium hyroxide gel 170ml , syp benadryl bott of 160 ml johnson johnson , syp b vitamin b compex multivitamin b 12 bott of 200 ml , syp calcium with vitamin d3 160 ml bott , syp cetrizine 60ml , syp chlorpheniramine maleate pcm phenylephrine 60ml common cold , syp cough expectorant 5ml containing diphenhydramine bott of 100ml , syp iron for adults with vitamins 200ml , syp lactulose bottle of 100ml dufalac , syp ofloxacine 100mg 5ml metronidazole200mg 5ml 30ml , syp ondansetron 2mg 5ml in 30ml , syp combiflam bott of 60 ml , syp paracetamol 250 mg , syp salbutamol 2mg 5ml bottle of 100ml , syp sucralfate bott of 200ml , drop dicyclomine simethicone 10 ml , mouth wash chlorhexidine 100ml colgate , oint diclofenac nanoforte gel tube of 30 gm , oint anti haemorhoidal , oint clindamycin phosphate 1 topical gel tube of 10gm , oint luliconazole 1 30gm , oint miconazole nitrate tube of 15gm , oint mouth ulcer gel , oint mupirocin 2 5gm , oint povidone iodine 5 tube of 10gm , oint silver sulphadiazine 1 tube of 15gms , oint clotrimazole tube of 15 gm , cream urea bott of 20 gm , cream sunscrean lashield , lotion calamine 100ml , lotion dynapar qps bott of 50 ml , gargle povidone iodine bott of 100 ml , spray analgesic voliny spray , liq povidone iodine 5 100ml , e d tear plus cmc refresh tear , e d ciprofloxacin dexamethasone 5ml cipla , e d moxifloxacin 05 5ml cipla , mouth paint clotrimazole bott of 5 ml , ear d waxsole bott of 15 ml , pdr clotrimazole 1 bott of 75mg , sachet calciferol 60000 iu cadila , sachet isabgol ispaghula husk 3 point 5gm , sachet oral rehydration salt ors 20 point 5g , inhalar seroflo 250 mcg , n d sodium chloride 0 point 65 15ml nasoclear , n d xylometazolidine 10ml adult , nd oxymetazoline hcl , disposable mask triple layer , dressing medicated adhesive 25cmx 6cm single strip pack band aid , bandage crepe15cm , hand sanitizer 100 ml bott , sanitary pad , steamer , nebuliser , bp apparatus digital , tennis elbow support size l andxl , tynor portable ortho heating pad , elbow support , ankle support , arm sling pouch , knee cap tynor size m and l , l s belt tynor size m and l , silicon heal pad tynor , walker , walking stick , wheel chair foldable , glucometer strips accucheck active bot of 50 , glucometer accucheck active , cervical collar tynor , powder protein 200gm , pdr glucose d pkt of 30 gm , lotion v wash bott of 100 ml , shampoo scalpe plus ketokonazole , tab sitagliptin 50 mg , tab tamsulosin 0 point 4 mg , syp liv 52 , tab meftal spas , tab zinc sulphate 20 mg , syp zinc 20 mg 5ml cap autrin pizer, cap becosule z, tab b compex zevit, cap doxycycline hydrocloride 100mg, cap evion 400 mg, cap itraconazole 200mg, cap pantop dsr, cap tripsyn and chymotripsyn chymoral forte, tab aceclofenac plus serratiopeptidase plus paracetamol, tab albendazole 400mg, tab amlodipine besylate 5mg, tab amoxycillin 500mg clavulanic acid 125mg gsk, tab antacid chewable abbott, tab aspirin 75mg usv, tab atorvastatin 10mg, tab azithromycine 500mg alembic, tab bisacodyl 10 mg, tab calcium carbonate 500mg plus vit d3 shalcal, tab cefixime 200mg, tab cetrizine dihydrochloride 10mg, tab clopidogrel 75mg, tab combiflam sanofi, tab common cold sinarest, tab cough lozenges, tab cipzox cipla, tab diclofenac sodium 50mg novartis, tab dicyclomine hcl 20mg paracetamol 325mg, tab domperidone 10mg, tab fexofenadine 180mg sanofi, tab fluconazole 150mg, tab folic acid 5mg, tab glimepride 1mg, tab glucosamine 500 mg, tab indapamide, tab levocetrizine 5mg, tab limcee 500 mg, tab losartan 50mg, tab liv 52, tab metformin sr 500 mg, tab methylcobalamine 1500mcg, tab montelukast

Central Government/Public Sector

TRN :35615082 | 21 Oct, 2025

Tender Value : 0

Kota - Rajasthan

Tender for gem bids for echs, itopride 50 mg tab itraconazole 100mg tab ivabradine 5 mg tab ketoconazole 2 percent cream ketoconazole shampoo 2 percent bottal of 60 ml ketorolac 10 mg tab labetalol 100mg tab lactitol 10gm ispaghula 35gm powder lamotrigine50 mg tab leflunomide arava 10 mg tab levetiracetam sr 500 mg tab levocarnitine 500mgmethycoba 1500 folic acid 15 mg tab levocetrizine5mg montelukast 10mg tab levocetrizine 5mg tab levodopa 100mg carbidopa 10mg tab levodopa100mg carbidopa 25mg tab levodopa 200 mgcarbidopa 50 mg cr tab levoflox 500 mg tab levosalbutamol 100mcg beclometasone 100mcgrotacap levosalbutamol 50mcg beclometasone50mcg inhaler levosulpiride 75mg esomeprazole40mg cap lignocaine jelly with plastic nozzle linagliptin 5 mg tab linezolid 600 mg tab lorazepam 1 mg tab l-ornithine l aspartate tab losartan 25mg tab losartan 50 mg tab losartan50mg hydrochlorthiazide 125mg tab luliconazolecream mebeverine 135 mg tab metformin 500 mgvildagliptin 50 mg tab metformin sr 1000 mg tab metformin sr 500 mg tab methotrexate 15 mg tab methylcobalamin 1500mcg alpha lipoic acid 100mgmyoinositol 100mg folic acid 15mg chromiumpicolinate 200mcg selenium 55mcg benfotiamine150mg cap methylcobalamin 1500 mg tab methylprednisolone 8 mg tab methylprednisoloneacetate 80mg inj metoprolol 25 mg tab metoprolol sr 50 mg tab micronised flavonoid500mg tab mirabegron 25mg tabor cap mirabegron 50 mg tab mirtazapine 15 mg tab montelukast 10 mg tab moxonidine 02mg tab bid number gem2025b6737421 dated 11-10-2025 bid document1 83 0 0 multivitamin and multimineral tab, mupirocin 2percent oint 5 gm, mycophenolate 500 mg tab, mycophenolate sodium 360mg tab, nandrolonedeconate 50 mg inj, naproxen 500 mg tab, neomercazole 10mg tab, neurobion forte tab, nicorandil 5 mg tab, nifedipine retard 20 mg cap ortab, nitrofurantoin 100 mg cap, norfloxacin400mg tinidazole 600mg tab, normal saline 500ml, nortriptyline 25 mg tab, ofloxacin 200mg tab, ointbeclomethasone salicylic acid, oint miconazole 20gm, olanzapine 10 mg tab, olanzapine 5 mg tab, olmesartan 20 mg tab, olmesartan 40 hctz 12.5 mgtab, olmesartan 40 mg tab, olopatadine 0.1percent bottle of 5 ml eye drop, omega fatty acidantioxidant cap, ondansetron 8 mg tab, oralteething sol zytee mouth lotion 10ml mouth ulcergel, ors sachet, oxcarbazepine 150 mg tab, oxcarbazepine 300mg tab, pantaprozole 40 mgdomperidone 10 mg pan d, paracetamol 500 mg tab, paracetamol 500mg ibuprofen 400mg tab, paracetamol 650 mg tab, paradichlorobenzene 2percent benzocaine 2.7 percent chorbutol 5percent turpentine oil 15 percent ear drop, paroxetine 12.5mg tab, permethrin 5 percent tubeof 30 gm, phenytoin sodium 100 mg, piracetam 800mg tab, polyethelen glycol and propylene glycoleye drop, polyethylene glycol purgative powder ip118gm sod chloride 2.93 gm pot chloride 1.484 gmsod bicarb 3.37 gm sod sulphate 11.35gm, povidoneiodine gargle, povidone iodine sol 10 percentbottle of 100 ml, povidone iodineip 5 percent tubeof 15 gm, pramipexole 0.5 mg tab, prasugrel 10 mgtab, prazosin sr 2.5 mg tab, prazosin sr 5 mg tab, prednisolone 10mg tab, prednisolone 5 mg tab, pregabalin 50 mg tab, pregabalin 75 mgnortriptyline 10 mg methylcobalamin 1500 mcg tab, pregabalin 75 mg ntp 10 mg tab, pregabalin 75mgmethylcobalamin 750 mg tab, pregabalin sr 75 mgtab, prepro probiotic tab, prochlorperazinemaleate 5 mg tab, propranol 40 mg tab, propranolol 10 mg tab, protein powder pack of 200gm, pulv protein supplement formula for renalpatient 200 gm, pyridoxin 40 mg tab, quetiapine 50mg tab, rabeprazole 20 mg tabitopride 50 mg tab, itraconazole 100mg tab, ivabradine 5 mg tab, ketoconazole 2% cream, ketoconazole shampoo 2% bottal of 60 ml, ketorolac10 mg tab, labetalol 100mg tab, lactitol 10gm +ispaghula 3.5gm powder, lamotrigine 50 mg tab, leflunomide arava 10 mg tab, levetiracetam sr500 mg tab, levo-carnitine 500mg methycoba 1500folic acid 1.5 mg tab, levocetrizine 5mg +montelukast 10mg tab, levocetrizine 5mg tab, levodopa 100mg + carbidopa 10mg tab, levodopa100mg + carbidopa 25mg tab, levodopa 200 mg +carbidopa 50 mg cr tab, levoflox 500 mg tab, levosalbutamol 100mcg + beclometasone100mcg rotacap, levosalbutamol 50mcg +beclometasone 50mcg inhaler, levosulpiride75mg + esomeprazole 40mg cap, lignocaine jellywith plastic nozzle, linagliptin 5 mg tab, linezolid600 mg tab, lorazepam 1 mg tab, l-ornithine l-aspartate tab, losartan 25mg tab, losartan 50 mgtab, losartan 50mg + hydrochlorthiazide 12.5mgtab, luliconazole cream, mebeverine 135 mg tab

Central Government/Public Sector

TRN :35605908 | 01 Nov, 2025

Tender Value : 90.08 Lacs

Jabalpur - Madhya Pradesh

Tender for gem bids for general, bid number gem2025b6714303 dated 11-10-2025 bid document1 73 0 0 clotrimazole eardrops, coenzyme q to 10 100 mgtab, coenzyme q 300 mg tab, collagen basedgranules, collagen peptide plus hyaluron, collagen peptide 40 mg plus sod, combipack ofamoxicillin 750, cotrimoxazole ds tab, cremaffinliquid paraffin 1.25, cudcee forte tab, cyclosporin50 mg tab, cyproheptadine 4 mg tab, dabigatran 75mg tab, dabrafenib 50 mg tab, dabrafenib 75 mgtab, daflon 500mg diosmin 450 mg, dapagliflozin 10mg plus metf, dapagliflozin 5 plus linaglip, dapagliflozin 5 mg plus metf, deca peptide lotion, deflazacort 12 mg tab, deflazacort 30 mg tab, dental gel, denture adhesive powder, desidustat50 mg tab, desloratadine 10 mg tab, desloratadine5 mg tab, desvenlafaxine 100 mg tab, desvenlafaxine 25 mg tab, desvenlafaxine 75 mgtab, dettol 100 ml bottle, dettol 500 ml bottle, diclofenac plus paracetamol, diclofenac 100 mgplus metaa, diclofenac 50 mg plus serrat, diclofenac gel of 10 gm vovrn, dicyclomine dropsof 15 ml syp, dienogest 2mg, diltiazem 30 mg tab, diltiazem cd 120 cap per tab, diltiazem gel, diosminplus hesperidin 1000, disodium hydrogen citrate s, distilled water, divalproex 250 mg tab, divalproexsodium cr 500 nos, divalproex sodium sr 1000 nostab, donepezil 5mg plus memantine, dosulepin 25 mgdothiepin tab, drotaverine 80 mg plus aceclo, duloxetine 10 tab, duloxetine 30 mg tab, dynaparqps plus spray, ed 0.2 percent olopatadine hydr, edbimatoprost 0.01 percent, ed boric acid, edbrinzolamide 1.0 plus timoll, ed bromfenac 0.09percent, ed bromofenac, ed candibiotic, eye dropcarboxy methyl cell, ed cyclosporine 0.05 percent, ed fluorometholone acetate, ed hydroxy propylmethylcellu, ed loteprednol 0.5 percent plus, ednetarsudil 0.02 percent, ed olopatadine plusketorolac, ed potassium iodide sodium, edprednisolone 1 percent, ed travaprost plus timolol, empagliflozin 5 mg plus metf, enalapril 10 mg tab, enteral feed powder protein, epalrestat 150mgplus methyl, escitalopram 10 mg plus clo, escitalopram 20 mg tab, escitalopram 5 mg plusclona, esmoprazole 20 mg tab, esomeprazole 20mg plus do, esomeprazole 20 mg tab, esomeprazole40 mg racipr, esomeprazole 40 mg plus cla, etodolac 300mg tab, etodolac 400 mg tab, etofylline 77 mg plus theophy, etophylin 77 mg plustheophylin, etophyllin 150 mg plus theo, etoricoxib60 mg tab, evening primrose 500 mg tab, eveningpromise 1000 cap, eye drops gentamycin plus //bid details2 / 73

Central Government/Public Sector

TRN :35600769 | 31 Oct, 2025

Tender Value : 0

Dimapur - Nagaland

Tender for gem bids for sadhbhavna, bid number gem2025b6659728 dated 10-10-2025 bid document1 75 0 0 tab ranitidine 150 mg, tab norflox 400 mg and tinidazole600 mg, tab azithromycin 500 mg, tab diclofenac sodium50 mg, tab neurobion forte, tab norfloxacin 400 mg, tabalbendazole 400 mgg, tab fluconazole 150 mg, tabantacid, tab amlodipine 5 mg, tab promethazinetheoclate 25 mg, syp multivitamin, syp antacid, sypcefixime 50 mg 5 ml bott of 30 ml, oint diclofenac gel 30gm, diclofenac spray, tab calcium 500 mg shelcal, tabfolic acid 5 mg, syp lactulose, ear drop paradichlorobenzene benzocaine 2.7 chlorbutol turpentine oil15 bott of 10 ml waxole, knee cap, ls belt lumbar belt, lotion calamine bott of 100 ml, tab vitamin c, tabmultivitamin, tab ibuprofen and paracetamol, tabdomperidone 10 mg, tab deriphylline, tab clotrimazolevaginal pessaries, tab bisacodyl 10 mg, tab pheniraminemaleate 25 mg, tab anticold, syp iron, syp coughexpectorant 100 ml, syp cetrizine, amoxycillin clavulanicacid syp in 30 ml bott, powder protein, pulv clotrimazole, oint miconazole, oint clobe gm, band aid, asthallininhaler, tab diclofenac potassium and serratiopeptidase, tab haematinic, oint povidone, crepe bandage 10 cm, roller bandage 10 cm, cotton 50 gm, lotion povidoneiodine 10 percent bott of 100 ml, syp tixliyx, nasal dropxylometazoline 10 ml, tab ramipril 5 mg, tab mefanamicacid and dicyclomine, tab ecosprin 75 mg, tabbetahistidine 4 mg, tab tinidazole 500 mg, syppromethazine bott of 60 ml phenargan, syp metronidazoleand oflox bott of 30 ml, syp salbutamol 4 mg, sypbromhexine hcl bott of 100ml, syp triaminic 60 ml, dropmultivitamin bott of 15 ml, drop antispasmodic 15 ml, eyedrop ciprofloxacin and dexamethasone bott of 10 ml, dropnasoclear normal salaine, eye drop flurbiprofen bott of 10ml, ear drop carboxymethylamino amino diphenylsulphone dibucaine and n n dihydroxymethyl carbamide, permethrin 5 percent tube of 30 gm, cream framycetinsulphate bp 1 percent tube of 30 gm, oint clindamycinphosphate 1 percent topical gel tube of 10 gm, gel cholinesalicylate and benzalkonium chloride gel of 10 ml, crepebandage 15 cm, tape micropore 2, ketoconazole lotion 2percent bott of 75 ml, pulv glucose 500 gm, rollerbandage 6 cm, non sterile hand gloves s 7, non sterilehand gloves s 7.5, disposable syringe 2 ml, disposablesyringe 5 ml, inj metronidazole, ns 500 ml, inj heparin, inj ciprofloxacin, inj deriphyllin, inj buscopan, tabacyclovir 400 mg, tab diazepam, tab chloroquine 500 mg, inj pantoprazole, tab metformin sr 500 mg, tabglimipride 2 mg, tab metformin 1 gm, tab indapamide sr, betadine gargle, tab cefuroxime 500 mg, oint acyclovir, inj thiamine, inj vitamin d3, inj ethamsylate, tabciprofloxacin and tinidazole, syp cremaffin, syp liv 52, ear drop clotrimazole and lignocaine

State Government

TRN :35601373 | 01 Nov, 2025

Tender Value : 93.00 Lacs

Anand - Gujarat

Tender for gem bids for boqbunchrecurring, guide-it mutation detection kit gibson assembly cloningkit in-fusion hd cloning plus ce monarch or genelutespin dna gel extraction kit monarch or genelute spinplasmid miniprep kit cathode buffer container anodebuffer container bigdye terminator v31 cycle sequencingkit 1 pop-7 polymer cdna synthesis kit sybr green kit guide-it complete sgrna screening system acquitypremier peptide csh c18 column acquity uplc beh c18column waters acquity column in-line filter mfei-hf kpni-hf pmli bglii ecori-hf saci-hf sali-hf sbfi-hf fastdigest acc65i fastdigest maubi 10x tris acetateboric acid dithiothreitol dtt cysteine dmso depc carbecillin disodium cefotaxime powder kanamycinesulphate monohydrate rifampicin streptomycin sulphate hygromycin b 2 4-dichlorophenoxyacetic acid indole-3-acetic acid indole-3-butyric acid picloram 6-bap kinetin zeatin ga3 l-glutamine l-proline nitro bluetetrazolium riboflavin sodium carbonate proteaseinhibitor cocktail hydrogen peroxide solution guaiacol trichloroacetic acid hypergrade for lc-ms lichrosolvmethanol hypergrade for lc-ms lichrosolv acetonitrile acetic acid aluminum chloride acrylamide crystals amino acid standard - waters boron trifluoride etherate n-a-benzayal-l-arginine ethyal ester hydrochloride p-cumaricacid trans cinamic acid caffeic acid chlorogenic acid dihydroxy toluene 3-5 dimetoxi-4-hidroxicinamic diosgenin diethyl pyrocarbonate dithiothreitol 100 bpdna ladder-dye plus o-dianisidine l-dopa trans ferulicacid 99 alpha-glucosidase 4-hydroxy -3 methoxy benzoicacid jasmonic acid maltose mercuric oxide red myricetin nitroblue tetrazolium chloride napthyl acetate narginine papain phenyl methane sulphonyl fluoride protease phenazine methosulphate quarcetin saponin bid number gem2025b6772281 dated 11-10-2025 bid document1 130 0 0 sybr premix - tli rnas h plus, syringic acid, sinapic acid, sodium arsenate dibasic hydrate, 37 components fame mix, 2 3 5- tri phenyl tertazolium bromide, 2 4 6-tris 2-pyridyl-s-triazine, tannic acid, nnnn-tetramethyl ethylenediamine, vanilic acid, water sterile nuclease free, aflatoxin g1, aflatoxin g2, aflatoxin b1, aflatoxin b2, hemicellulase, alcalase, phytic acid assay kit, trypsinactivity assay kit, 2 2-diphenyl-1-picrylhydrazyl, meta-phosphoric acid, amylose, l-amino acid assay kit, n-benzoyl-dl-arginine-p-nitroanilide bapa, trypsin - porcinepancreatic, methanol hplc grade, pancreatin, pepsin, potassium thiocyanate kscn, tannic acid standard, vanillin, tri chloro acetic acid, tris base, anthrone, hppvessel gasket, hpp sensor probe, pectinase, cellulase, phytic acid assay kit, tannin microplate assay kit, saponinmicroplate assay kit, n benzoyl-dl-arginine p-nitroanilidehydrochloride, trypsin solution, phosphotungsticphophomolybdic acid, neutrase, orthophthaldehyde, 2-mercaptoethanol, l-glutathione, l-serine, ultra centrifugalfilter 3 k da mwco, alpha glucosidase, ace inhibitoryactivity assay, indophenol dye, betacyanin, tuning andperformance standards for lc ms, methyl myristate, linolenic acid methyl ester, amino acid kit, 3 5-dinitrosalicylic acid reagent, p-nitrophenyl a-d-galactopyranoside, trypsin edta, acrylamide, n n-methylene bis-acrylamide, n n n n-tetramethylethylenediaamine, fluorometric, l-tyrosine, antimicrobial susceptibility test discs, mcfarlandstandard, phenol chloroform isoamyl alcohol, listeriamonocytogenes detection kit, dna ladder 100 bp, glycine-sodium hydroxide buffer, potassium acetate, betanin, quercetin, kaempferol, 96-well polystyrene microtiterplate, indicaxanthin, 2 2-diphenyl-l-picrylhydrazyl, proteinstandards for electrophoresis, acarbose extrapure, trisacetate edta buffer, tris borate edta buffer, listeriamonocytogenes atcc 700301 lyophilized culture, listeriamonocytogenes atcc 700302 lyophilized culture, papayamosaic virus elisa kit, papaya ringspot virus elisa kit, papaya leaf curl virus elisa kit, soybean mosaic viruselisa kit, urdbean crinkle virus elisa kit, mungbeanyellow mosaic virus elisa kit, okra enation leaf curl elisakitguide it mutation detection kit, gibson assemblycloningkit, in fusion hd cloning plus ce, monarch or genelute spindna gel extraction kit, monarch or genelute spin plasmidminiprep kit, cathode buffer container, anode buffercontainer, bigdye terminator v3.1 cycle sequencing kit 1, pop 7 polymer for 3500seqstudio flex, cdna synthesis kit, sybr green kit, guide it complete sgrna screening system, acquity premier peptide csh c18 column, acquity uplcbeh c18 column, waters acquity column in-line filter, mfei hf, kpni hf, pmli, bglii, ecori hf, saci hf, sali hf, sbfihf, fastdigest acc65i, fastdigest maubi, 10x tris acetateboric acid, dithiothreitol dtt, cysteine, dmso, depc, carbecillin disodium, cefotaxime powder, kanamycinesulphate monohydrate, rifampicin, streptomycin sulphate, hygromycin b, 2, 4 dichlorophenoxyacetic acid, indole 3acetic acid, indole 3 butyric acid, picloram, 6 bap, kinetin, zeatin, ga3, l glutamine, l proline, nitro blue tetrazolium, riboflavin, sodium carbonate, protease inhibitor cocktail, hydrogen peroxide solution, guaiacol, trichloroacetic acid, hypergrade for lc ms lichrosolv methanol, hypergrade forlc ms lichrosolv acetonitrile, aflatoxin g1, aflatoxin g2, aflatoxin b1, aflatoxin b2, hemicellulase, alcalase, phyticacid assay kit, trypsin activity assay kit, 2, 2 diphenyl 1picrylhydrazyl, meta phosphoric acid, amylose, l amino

Central Government/Public Sector

TRN :35584342 | 30 Oct, 2025

Tender Value : 0

East Khasi Hills - Meghalaya

Tender for gem bids for cholesterol fsr 4x25 ml , triglyceride fsr 4x25 ml , glucose fsr 5x100 ml , urea fsr 4x20 ml 4x5 ml , creatinine fsr 2x25ml 2x25ml , direct bilirubin fsr 4x25ml , total bilirubin fsr 4x25ml , sgpt fsr 4x20ml 4x5ml , sgot fsr 4x20ml 4x5ml , hdl cholesterol fsr 4x25 ml , total protein fsr01 4x50ml , albumin fsr01 4x50ml , accu chek active glucose test strip , urinalysis reagent strips , trop t test kit , typhoid igg igm rapid test kit , hbsag rapid test kit , crp test kit , rf ra rheumatoid factor rheumatoid arthritis test kit , prega news upt kit , anti-snake venom , rabies vaccine xprab vaccine , test tube 5 ml , thomas splint , thumb spica splint , knee immobilizer splint 19 inch , universal shoulder immobilizer , wrist and forearm splint , forearm splint , pelvic splint , tab avil , tab digene , tab calpol 650 , tab levocetrizen 5 , augumentin duo syrup , tab sorbitrate , tab amlokind 5 , cap unienzyme , respules asthalin , respules duoline 3 , tab dericip retard 150 , tab lopramide , injection ondem , electoral powder , larinate 200 kit tablet , lipikind 20 tablet , asthalin 4 tablet , acimol 100mg 325mg tablet , montina l tablet , aciloc 150 tablet , eye drop ciplox d , eye drop eyelet , calpol 250 mg syrup , pcm 100 mg drop , injection mvi , naselin saline spray , micropipette tips 5 , iv set , paper tap , gauze than , ecg gelly

Central Government/Public Sector

TRN :35573595 | 23 Oct, 2025

Tender Value : 0

Gurdaspur - Punjab

Tender for gem bids for pregabalin 50 mg tab pregabalin 75 mgnortriptyline 10mg methylcobalamin 1500 mcg tab pregabalin 75 mgntp10 mg tab pregabalin 75mgmethylcobalamin 750 mg tab pre pro tab primidone 25 mg tab prochloroperazine5mg tab prochlorperazine maleate 5 mg tab propranol40 mg tab propranolol tr 40 mg tab protein powdertinof 500gm protein supplement formula for renalpatientbox of 200 gm prucalopride 1 mg tab prucalopride 2 mg tab pyrazinamide 1500 mg tab pyridostigmine 60 mg tab pyridoxin 40 mg tab pyridoxine 10 mg tab pyridoxine 20 mg tab quetiapine100 mg tab quetiapine 25 mg tab quetiapine 50 mg tab quetiapine sr 100 mg tab rabeprazole 20 mg tab racecadotril 100 mg cap raltegravir 400 mg tab ramipril 125 mg tab ramipril 25 mg tab ramosetron 5mcg tab ranitidine 150 mg tab ranolazine 500 mg tab rasagiline 05 mg tab rasagiline 1 mg tab repaglinide 1mg tab rifampicin 450 mgisoniazid 300 mg cap rifampicin 600 mgtab inh 300mg tab rifaximine 200 mgtab rifaximine 400 mg tab riluzole 50 mg tab risperidone 05 mg tab risperidone 1 mg tab risperidone 2 mg tab risperidone 3 mg tab risperidone4 mg tab rivaroxaban 10 mg tab rivaroxaban 15mg tab rivaroxaban 25 mg tab rivaroxaban 20 mg tab rivastigmine 15 mg cap rivastigmine 3 mg tab rizatriptan 10 mg tab rizatriptan 5 mg tab ropinirole05 mg tab rosuvastatin 10 mg tab rosuvastatin10mgaspirin 75mg tab rosuvastatin 20 mg tab rosuvastatin 40 mg tab rotahaler for rotacaps sadenosyl l methionine 200 mg tab s adenosyl lmethionine 400 mg tab sachet preprobioticfructooligosaccharide bifidobacteriumstreptococcuslactobacillus sacubitril 97 bid number gem2025b6674121 dated 08-10-2025 bid document1 137 1 1 mg, valsartan 103 mg tab, salbutamol 200 mcg rotacap, salbutamol 4mg tab, salbutamole 2.5 mg respule, salmeterol 50mcg, fluticasone propionate 250mcg accuhaler, salmeterol 50mcg, fluticasone propionate 250mcgrotacap, bott of 30, salmetrol 50 mcg, fluticasone 125 mcgmdi, saxagliptin 2.5 mg tab, selegiline 5 mg tab, serratiopeptidase 10 mg tab, sertraline 50 mg tab, sevelamer 400 mg tab, sevelamer 800 mg tab, sildenafilcitrate 50 mg tab, silodosin 4 mg, dutasteroide 0.5 mg tab, silodosin 4 mg tab, silodosin 8 mg, dutasteroide 0.5 mgtab, silodosin 8 mg cap, silymarin 70 mg tab, sitagliptin50 mg tab, sitagliptin 50 mg tab, metformin 1000 mg tab, sod valproate 200 mg cr tab, sodium bicarbonate 1000mg tab, sodium picosulphate 10 mg tab, sodiumvalproate, valproic acid 200 mg tab, sodium valproate 300mg cr tab, sodium valproate 500 mg tab, sodiumvalproate oral sol 200mg per 5ml bott of 100 ml, sofosbuvir 400mg, velpatasvir 100mg cap, sofosuvir 400mg, daclatasavir 60 mg tab, solifenacin 10 mg tab, solifenacin 5 mg tab, spironolactone 25 mg, frusemide 20mg tab, spironolactone 50 mg tab, sulfasalazine 500 mgtab, sulphamethaxaxol 800 mg and trimethoprim 160 mgds tab, tab 5 amino salicylic acid sr 1.2 mg mesalamine, tab acarbose 25 mg, tacrolimus 0.25 mg tab, tacrolimus0.5 mg tab, tacrolimus 1 mg tab, tacrolimus 2 mg tab, tadalafil 10 mg tab, tadalafil 20 mg tab, tamoxifencitrate 20 mg tab, tamsulin 0.4 mg, dutasteride 5 mg tab, tapentadol 50 mg tab, taurine 500 mg, acetylcystine150mg tab, telmisartan 20 mg tab, telmisartan 40mg, amlodipine 5 mg tab, telmisartan 40mg, chlorthalidone 12.5 mg tab, telmisartan 40mg, amlodipine 10 mg tab, telmisartan 80 mg, hctz12.5mg tab, telmisartan 80 mg tab, tendocare tab, teneligliptin 20mg tab, tenofovir 300 mg, emtricitabine200mg, efavirenze 600mg tab, tenofovir 300mg, lamivudine 300mg, efavirenze 400mg tab, tenofovir300 mg, lamivudine 300mg, dolutegravir 50mg, tenofovir300 mg tab, tenofovir alafenamide 25 mg tab, tetrabenzeme 25mg tab, thalidomide 50 mg tab, thiamine 100mg tab, thiocolchicoside 4 mg tab, thiocolchicoside 8 mg tab, thyroxin 12.5 mcg, thyroxin125 mcg tab, thyroxin 62.5 mcg, thyroxin 88 mcg tab, thyroxine 25 mcg tab, thyroxine 37.5 mcg tab, thyroxine50 mcg tab, thyroxine 75 mcg tab, tianeptine 12.5 mgtab, tiotropium 18 mcg rotacap, tiotropium bromide 9mcg, formoterol 6 mg, ciclesonide 200 mcg, mdi of 200doses, tofacitinib 11 mg tab, tolperisone sr 150 mg tab, tolpersone 50 mg tab, tolterodine 2 mg tab, tolvaptan 15mg tab, topiramate 25 mg tab, topiramate 50 mg tab, torsemide 100 mg tab, torsemide 10 mg, spironolactone50 mg tab, torsemide 10 mg tab, torsemide 20 mg tab, torsemide 40 mg tab, torsemide 5 mg tab, tramadol 50mg, paracetamol 325 tab, tramadol 50 mg cap, tramadol, dicyclomin, acetaminophen, tranexamic acid 500mg, mefenamic 250 mg tab, tranexamic acid 500 mg tab, trazodone 25 mg tab, trazodone 50 mg tab, trifluoperazine 5 mg tab, trihexyphenidyl 2 mg tab, trimetazidine 20 mg tab, trimetazidine 60 mg cap, trimetazidine mr 35 mgtab, trypsin, chymotrypsin 1 lakhau enteric coated tab, trypsin, chymotrypsin 50000au, diclofenac 50mg tab, ubidecarenone 300 mg tab, ubiquinol acetate 100 mg tab, ursodexycholic acid 300mg tab, valacyclovir 500 mg tab, valsartan 40 mg tab, venlafaxine 37.5 mg tab, verapamil 120mg sr tab, //bid details2 / 137 verapamil 40 mg tab, verapamil 80 mg tab, vericiguat 10mg tab, vericiguat 2.5 mg tab, vilazodone 20 mg tab, vildagliptin 50mg tab, vitamin a cap, vit b complex with aminimum concentration of vit b1 5 mg, vit b6 3 mg vit b125 mcg therapeutic tab or cap, voglibose 0.3 mg tab, warfarin 2 mg tab, warfarin 3 mg tab, warfarin 5 mg tab, zinc 158 mg tab, ziprasidone 20 mg tab, zolpidem 10mg tab, zolpidem 5 mg tab

Central Government/Public Sector

TRN :35574939 | 30 Oct, 2025

Tender Value : 1.44 Lacs

Rajouri - Jammu And Kashmir

Tender for gem bids for echs, sodium bicarbonate 1000mg tab, inj zoledronic acid 4 mg, tab escitalopram plus clonazepam, rasogiline 0 point 5mg tab, prucalopride 1 mg tab, tizanidine 2mg tab, piracetam 800mg tab, bethanecol chloride 25 mg urotonetab, tab rivaroxaban 15 mg, desmopressin 0 point 1 mgtab, eye drop olapatadine plus ketorolac, ketorolactromethamine 0 point 4 percent eye drop eye drop, oloptadine hydrochloride 0 point percent opthalmic solnpoint bott of 5 ml, linseed oil diclofenac diethylaminemethyl salicylate and methnol spray, ketoconazole lotion 2percent zinc pyrithione 1 percent w v shampoo bott of100ml, softgel cap of coenzyme q 10 lycopene omega 3fatty acid, softgel cap of coenzyme q 300, protein powderbott of 500 gm, lumbar belt size s m l xl and xxl, cervical collar soft size s m l xl, arm sling pouch, compression stocking above knee size s m l, compressionstocking below knee size s m l, benzoyl peroxide 2 point 5percent tube of 20 gm oint, alprazolam of 0 point 25 mgtab, tab bosentan 125 mg, evening primrose cap 500mg, unsterile surgical hand gloves size 6 point 5, unsterilesurgical hand gloves size 7, unsterile surgical hand glovessize 7 point 5, pulv glucose pkt of 1 kg, inh formetrol 6mcg plus fluticasone 250 mcg, tenofovir 300 mg plusemitractabine 200mg plus efavirenz 600mg combination pill, tab ketorolac 10 mg dt, alprazolam 0 point 5 mg tab, ankle strap size s m l, ethambutol 800 mg tab, rifampicin450mg plus isoniazid 300mg tab, thyroxin sodium 75 mcgtab /bid number: gem/2025/b/6773520* /dated: 09-10-2025 & & / bid document1 / 33

Central Government/Public Sector

TRN :35565371 | 22 Oct, 2025

Tender Value : 0

Pondicherry - Puducherry

Tender for gem bids for procurement, 5-fluorouracil injection 50 mgperml amikacininjection 125 mgperml aminophylline injection25mgperml amphotericin b injection 50 mg antihuman thymocyte immunoglobulin rabbitinjection 5mgperml basiliximab injection injection20mg benzyl penicillin injection 600 mg 10 lac iu beractant intratracheal suspension 25mgperml carbetocin injection 100 mcgperml chlorpromazinehydrochloride injection 25 mgperml c-tb injection01 microgramper01 ml dalteparin sodium injection5000 iuper02 ml diltiazem hydrochloride injection5 mgperml doxylamine succinate plus pyridoxinehydrochloride injection fluconazole infusion 2mgperml injection fluorescein sodium injection10percent wperv fluorescein sodium injection20percent wperv glucagon hydrochloride injection1mg glyceryl trinitrate injection 1 mgperml hepatitis b immunoglobulin 100 iuper05 ml hepatitis b vaccine genetically engineered 05 ml human albumin injection 45percent human rabiesimmunoglobulin injection 300 iu insulin aspartinjection 100units per ml insulin detemir injection100unitsperml insulin glargine injection100unitsperml insulin-biphasic isophane insulininjection ip 30percent soluble insulin and 70percentisophane insulin 40 iuperml insulin-biphasicisophane insulin injection ip 50percent solubleinsulin and 50percent isophane insulin 40 iuperml insulin-isophane insulin injection intermediateacting 40 iuperml insulin-soluble insulin injectionrapid or short acting neutral solution 40 iuperml iron dextran injection 50 mgperml isoxsuprinehydrochloride injection 5 mgperml ketamine bid number gem2025b6761416 dated 07-10-2025 bid document1 110 1 1 hydrochloride injection 10 mgperml, ketaminehydrochloride injection 50 mgperml, levofloxacininjection 500 mgper20 ml, lignocaine hydrochloride21.3 mgperml with sodium chloride 6 mgpermlinjection i.v. preservative free, lorazepam injection2 mgperml, methotrexate sodium injection 25mgperml, methyldopa injection 50 mgperml, methylene blue injection 10mgperml, metoprololtartrate injection ip 1 mgperml, mitomycin cinjection 2mg, monoclonal purified antihemophilicfactor viii human injection 1000 iu, monoclonalpurified antihemophilic factor viii human injection250 iu, monoclonal purified antihemophilic factorviii human injection 500 iu, nicorandil injection 48mg, phenobarbitone sodium injection 200 mgperml, phenocaine intracameral preservative freeinjection, pilocarpine nitrate intracameralpreservative free injection, placenta extractinjection, pneumococcal polysaccharide vaccine 23valent 0.5 ml, polidocanol 3percent injection, prochlorperazine mesylate injection 12.5mg per ml, rabies human monoclonal antibody injection 50iuper1.25 ml, recombinant granulocyte monocyte-colony stimulating factor gm-csf 500ug, recombinant human growth hormone injection 0.45mgperml, remdesivir injection 100 mg, sodium 2-mercaptoethanesulphonate injection 100 mgperml, sodium tetradecyl suphate 3percent injection, streptomycin injection 0.75 g, terbutaline injection0.25 mg, tuberculin, purified protein derivativediluted 1 tuper0.1 ml, urokinase injection 5 lac iu, verapamil hydrochloride injection 2.5 mgperml, vitamin a injection 100, 000 iu, zoledranic acidinjection 5mgper100ml, atropine sulphate0.5mgperml ivf, haemo dialysis fluid acetatesolution, haemo dialysis fluid acid concentrate -without dextrose, inj. 3.5percent colloidal infusionsolution of polygeline with electrolytes for ivadministration, fentanyl citrate injection 50mcgperml, fentanyl transdermal patch - 5 mg, morphine sulphate 10mg tablet, morphine sulphateinjection 10 mgperml, pentazocine lactate injectionip 30 mgperml, pethidine hydrochloride injection 50mgperml, autolytic debridement gel, azithromycineye ointment 15percent wperw, benzyl peroxide gel2.5percent, chlorhexidine gluconate obstetriccream 1percentwperw, ciprofloxacin eye ointment0.3percent wperw, conjugated oestrogen 0.625 mgcream, dichloro metaxylenol obstetric cream 1.2percent wperv, estradiol 0.01percent vaginal cream, hydroquinone cream 2percent, salicyclic acid6percent ointment, sodium chloride opthalmicointment 6percentwperw, lactic acid bacilluspowder, l-arginine granules 5gms, nacetylcysteine 10percent solution for inhalationuse, salbutamol sulphate ip respiratory solution5mgperml, benzathine penicillin 2.4mu 1 vial plusazithromycin 1gm 1 tablet plus disposable syringe10ml 1 syringe plus sterile water 10ml 1 phial, activated charcoal 500mg tablet, amoxycillin125mg plus cloxacillin 125mg capsule, amoxycillin250mg plus cloxacillin 250mg capsule, ampicillin250mg capsule, artesenuate 100mg 3 tab plussulphadoxine pyremethemine 750mg plus 37.5mg 1 tab //bid details2 / 110 combi blister pack5-8 years, artesenuate 150mg 3tab plus sulphadoxine pyremethemine 500mg plus25mg 2 tab combi blister pack9-14 years, artesenuate 200mg 3 tab plus sulphadoxinepyremethemine 750mg plus 37.5mg 2 tab combi blisterpack adult, artesenuate 25mg 3 tab plussulphadoxine pyremethemine 250mg plus12.5mg 1 tabcombi blister pack0-1 years, baricitinib 4mg tablet, brincidofovir 100mg tablet, cephalexin 250mgcapsule, cetirizine 5mg tablet, chloramphenicol ip250mg capsule, chlorpheniramine maleate ip 4mgtablet, chlorpromazine hcl 50mg tablet, clindamycin 600mg tablet, clofazimine 100 mgtablet, cloxacillin 500mg capsule, co -trimoxazole pead tablet sulphamethoxazole 100 mgplus trimethoprim 20 mg, co-enzyme q10, l-carnitine, l-tartarate, l-arginine, dha and lycopene tablet, cyclosporine 75 mg capsule, dapsone 100 mg tablet, diethyl carbamazine citrate ip 100mg tablet, essential amino acids, vitamins, methylcobalamin andminerals capsules, etophylline 115mg plustheophylline 35mg tablet sr, griseofulvin 125mgtablet, griseofulvin 250mg tablet, indomethacin25mg capsule, irbesartan 150 mg tablet, isosorbide - 5 - mononitrate 30 mg tablet indurables, lecithin, silymarin, glutatione, zinc, amino acids and vitamin tablet, levocarnitine330mg tablet, levonorgestrel 1.5mg tablet, mebendazole 100mg tablet, mefenamic acid 250 mgtablet, methyl ergometrine maleate 0.125 mgtablet, misoprostol 25mcg tablet, misoprostol50mcg tablet, neostigmine 15mg tablet, niacinamide 500 mg tablet, nifedipine 5mg capsule, norfloxacin 100mg tablet, orciprenaline 10mgtablet, orciprenaline 20mg tablet, oseltamivir 30mg tabletpercapsule, pencillin g potassium 400400, 000 units tablet, phenobarbitone 30mg tablet, riboflavine 10mg, rifampicin 150mg tablet, rifampicin 300mg tablet, rifampicin 600mg tablet, ring pessary, rivaroxaban 10mg tablet, silymarin140 mg tablet, simethicone and activated charcoaltablet, sodium fluoride 20 mg tablet, taurine500mg with n- acetyl cysteine 50mg tablet, tecovirimat 200mg capsule, tetracycline hysrochlorude 500 mg capsule, voriconazole 400mgtablet, amisulpride 200mg tablet, amlodipine 5mgtablet, amoxycillin 250mg capsule, atorvastatin10mg tablet, escitalopram 10mg tablet, famotidine40mg tablet, glimipride 1mg tablet, isosorbidedinitrate ip 10mg tablet, norfloxacin 400mg plustinidazole 600mg tablet, prednisolone ip 5mgtablet, propranolol ip 5mg tablet, thyroxinsodium 25mcg tablet, 2 fdc paediatric-cp isoniazid50plusrifampicin 75 tablet, 3 fdc paediatric-ipisoniazid 50plusrifampicin 75pluspyrazinamide150tablet, clofazimine 100 mg capsule, cycloserine250 mg capsule, delamanid 50 mg tablet, ethambutol 100 mg tablet, ethambutol 200 mgtablet, ethambutol 400 mg tablet, ethambutol 800mg tablet, ethionamide 125 mg tablet, ethionamide25o mg tablet, isoniazid 100 mg tablet, isoniazid300 mg tablet, isoniazid 300mg plus rifapentine300mg 3hp fdc, rifampicin 150 mg capsule, rifampicin 300 mg capsule, rifampicin 450 mg //bid details3 / 110 capsule, rifampicin 600 mg capsule, bismuthsubnitrate and iodoform paste per pack bismuthsubnitrate 20percent, iodoform 40percent and liquidparaffin 40percent, fibrin sealant human kit, halothane solution, mercurochrome powder, podophyllin paint 20percent, sodalime indicator -pink, sodium lauryl sulphate, sodium benzoate andpropyleneglycol hand and body wash lotion, sodium phosphate enema sodium acid phosphate16percentwperv plus sodium phosphate 6percentwperv

Related Searched Keywords : protein powder

List of protein-powder Tenders

Get protein powder Tender Alert...

Related Searched Keywords : protein powder

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us