Thetenders.com
  +91 92760 83333 / +91 92743 15555
  • Indian Tenders
  • |
  • Global Tenders
  • |
  • Projects
  • |
  • Tender Awarded
  • |
  • Sub-Contractor
  • Pay Online
  • Register now
  • Login
  • Indian Tenders Tender information of India
  • Global Tenders International Tender information
  • Projects Project information of India
  • Tender Awarded Tender awarded information
  • Sub-Contractor Vendor information of India
  • Pay Online
  • Register now
  • Login
  • Contact Info All India : 9276083333 / 9274315555 South India : 9274315555
TheTenders
»
Indian Tenders
»
State Tenders
»
Uttaranchal
Filters
  • » By Keywords
  • » By Cities
  • » By States
  • » By Agencies
  • » By Sectors
  • » By Ownerships
  • Tender Value

List of uttaranchal Tenders

List of latest uttaranchal Tenders in Indian Tenders. Click on any uttaranchal Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for uttaranchal Tenders.

Advance Search
  • All-Tenders (1048)
  • |
  • Today's-Tenders
  • |
  • Active-Tenders
  • |
  • Closed-Tenders
1001 Construction
image image
State Government
TRN :35626787 |  06 Nov, 2025
Tender Value : 0
 Nainital - Uttaranchal
Tender for construction of interlocking tile internal road of parwati kunj-i udaypuri chopra in ramnagar constituency at district nainital under state sector
  • View Tender
  • Document
  • Bid Support
1002 Construction
image image
State Government
TRN :35626788 |  18 Nov, 2025
Tender Value : 2.15 Crore
 Tehri Garhwal - Uttaranchal
Tender for reconstruction and improvement work of devaldhar-chamolgaon motor road in narendranagar assembly constituency of tehri garhwal district under state sector. length 3.05 km.
  • View Tender
  • Document
  • Bid Support
1003 Health Services And Equipments
image image
State Government
TRN :35626839 |  06 Nov, 2025
Tender Value : 2.10 Crore
 Nainital - Uttaranchal
Tender for image guided system with radio frequency generator
  • View Tender
  • Document
  • Bid Support
1004 Power Plant
image image
corporations/Associations/Others
TRN :35626849 |  04 Nov, 2025
Tender Value : 0
 Tehri Garhwal - Uttaranchal
Tender for strengthening of strata and ground improvement works including channelization of leakage water flowing out from hrt of mb-ii hep at gamri gad, distt-uttarkashi.
  • View Tender
  • Document
  • Bid Support
1005 Construction
image image
State Government
TRN :35626866 |  03 Nov, 2025
Tender Value : 0
 Almora - Uttaranchal
Tender for appointment of consultant for preparation of design, drawing, dpr including architectural structural electrical sanitary interior design with a long term master plan of kot bharamari madir garur under manaskhand mandir mala mission phase ii
  • View Tender
  • Document
  • Bid Support
1006 Education And Research Institutes
image image
Central Government/Public Sector
TRN :35610475 |  03 Nov, 2025
Tender Value : 16.98 Lacs
 Nainital - Uttaranchal
Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5
  • View Tender
  • Document
  • Bid Support
1007 Security Services
image image
Central Government / Public Sector
TRN :35611457 |  03 Nov, 2025
Tender Value : 0
 Dehradun - Uttaranchal
Tender for gem bids for 7441122106 plug 321y024f42, 7441122122 plug321y027f42, 7441122820 mil grade miniature cable, 9927083887 connectorp, 2rmg18b7sh1e2b, 9927090135 connectorplug, 2rm18b7sh1v1, 9927099469 connector-plug dam15p
  • View Tender
  • Document
  • Bid Support
1008 Education And Research Institutes
image image
Central Government/Public Sector
TRN :35611797 |  03 Nov, 2025
Tender Value : 26.00 Lacs
 Nainital - Uttaranchal
Tender for gem bids for rainbow trout larval feed 0 point 3 mm pallet, rainbowtrout larval feed 0 point 5 mm pallet, rainbow trout larvalfeed 0 point 8 mm pallet, rainbow trout nursery feed 1point 2 mm floating pallet, rainbow trout grower feed 1point 8 mm floating pallet, rainbow trout grower feed 3mm floating pallet, rainbow trout grower feed 6 mmfloating pallet, rainbow trout nursery feed 0 point 8 mmpallet, rainbow trout early grower feed 1 point 2 mmfloating pallet, rainbow trout early grower feed 1 point 8mm floating pallet, carp feed 4 mm floating, plasticinsulated ice box, oxygen cylinder, weighing balance, drag net, hand net, hapa, polythene bag, silpoline, fishwader
  • View Tender
  • Document
  • Bid Support
1009 Security Services
image image
Central Government/Public Sector
TRN :35611955 |  03 Nov, 2025
Tender Value : 0
 Champawat - Uttaranchal
Tender for gem bids for monitor speaker with flight case, 15 inch two way stagemonitor, music system with 50w speaker
  • View Tender
  • Document
  • Bid Support
1010 Health Services/Equipments
image image
Central Government/Public Sector
TRN :35612173 |  12 Nov, 2025
Tender Value : 5.00 Lacs
 Dehradun - Uttaranchal
Tender for gem bids for laundry service - healthcare purpose
  • View Tender
  • Document
  • Bid Support
  • 1
  • ...
  • 97
  • 98
  • 99
  • 100
  • 101
  • 102
  • 103
  • 104
  • 105
  • Tenders Expired In - 2025
  • Tenders Expired In - 2024
  • Tenders Expired In - 2023
  • Tenders Expired In - 2022
  • Tenders Expired In - 2021
  • Tenders Expired In - 2020
  • Tenders Expired In - 2019
  • Tenders Expired In - 2018
  • Tenders Expired In - 2017
  • Tenders Expired In - 2016
  • Tenders Expired In - 2015
Other States
  • Daman And Diu Tenders ,
  • Jharkhand Tenders ,
  • Gujarat Tenders ,
  • Arunachal Pradesh Tenders ,
  • Chandigarh Tenders ,
  • Punjab Tenders ,
  • Assam Tenders ,
  • Puducherry Tenders ,
  • Andhra Pradesh Tenders ,
  • Chhattisgarh Tenders

Get Uttaranchal Tender Alert...

561692

Other States

  • Drainage Tenders From Daman And Diu
  • Grouting Tenders From Jharkhand
  • Underground Sewer Tenders From Gujarat
  • Interlocking Tile Flooring Tenders From Arunachal Pradesh
  • Drills Tenders From Chandigarh
  • Civil Infrastructure Work Tenders From Punjab
  • Rcc Dam Tenders From Assam
  • Cladding Work Tenders From Puducherry
  • Plastering Tenders From Andhra Pradesh
  • Irrigation Tenders From Chhattisgarh

Read More


Tender Document

943112

State Tenders »

  • Maharashtra Tenders
  • Delhi Tenders
  • West Bengal Tenders
  • Tamil Nadu Tenders
  • Andhra Pradesh Tenders

City Tenders »

  • Hyderabad Tenders
  • Visakhapatnam Tenders
  • Guwahati Tenders
  • Patna Tenders
  • Chandigarh Ut Tenders

Keyword Tenders »

  • Piling Tenders
  • Water Sump Well Tenders
  • Culvert Slab Tenders
  • Civil Engineering Service Tenders
  • Lift Irrigation Project Tenders

Sector Tenders »

  • Drugs And Pharmaceuticals Tenders
  • Survey Work Tenders
  • Shipping Transport Tenders
  • Scientific Research And Instruments Tenders
  • Security Services Tenders

Ownership Tenders »

  • Central Government And Public Sector Tenders
  • Co Operative Tenders
  • Corporations And Associations And Others Tenders
  • Private Sector Tenders
  • State Government Tenders

Indian Segment

  • State Tenders
  • City Tenders
  • Industry Tenders
  • SubIndustry Tenders
  • Sector Tenders
  • Ownership Tenders
  • Agency Tenders
  • Keyword Tenders
  • Source of Tenders

Browse Tenders

  • RFP-RFQ Tenders
  • Vender Registration Tenders
  • ICB Tenders
  • NCB Tenders
  • Auction Tenders
  • Corrigendum Tenders
  • E Procurement Tenders
  • GeM Tenders (Registration)

Global Segment

  • Middle East Countries Tenders
  • European Countries Tenders
  • African Countries Tenders
  • Asian Countries Tenders
  • Saar Countries Tenders
  • Australia Oceania Countries Tenders
  • South America Countries Tenders
  • North America Countries Tenders

Others

  • Services
  • Sitemap
  • About Us
  • Contact Us
  • Career
  • Tender Consultants
  • Terms & Conditions
  • Privacy & Policy

Get in touch with us

  • +91-92760 83333 (In India)
    +91-92743 15555 (South India)

  • sales@thetenders.com

W B


Copyright ©2018 - Thetenders.com.

Download Mobile App